]>MAD1973S0047-6374(97)00115-210.1016/S0047-6374(97)00115-2Elsevier Science Ireland LtdFig. 1The effect of EGF on [3H]thymidine incorporation. The serum-starved subconfluent cell monolayers in Falcon 24-well plates were exposed for 24 h to indicated concentrations of EGF in the presence of 2.5% FCS. The cells were labeled with [3H]thymidine for the last 6 h of culture and the radioactivity and DNA content determined as described in Section 2. The vertical columns are the means of four cultures and vertical bars indicate one standard deviation. All results are highly significant (Student `t' test) comparing experimental and the corresponding control (no EGF) culture.Fig. 2The effect of FCS, or FCS plus EGF on [3H]thymidine incorporation. The experimental conditions were as in the legend of Fig. 1. The [3H]thymidine incorporation and DNA content were determined 24 h after the cells have been exposed to the indicated concentrations of FCS or FCS plus 2.5 ng/ml EGF. Vertical columns are the means of four cultures and vertical bars indicate one standard deviation. The figures within columns are the ratios of the means: EGF-treated over the corresponding EGF-untreated cultures.Fig. 3The effect of FCS or FCS plus EGF on cell proliferation. The experimetal conditions were as in the legend of Fig. 1. The DNA content was measured 5 days after exposure of cells to the indicated concentrations of FCS or FCS plus 2.5 ng/ml EGF. Vertical columns are the means of six cultures and vertical bars indicate one standard deviation. The figures within columns are ratios of the means: EGF-treated over the corresponding EGF-untreated cultures.Fig. 4The time-course of the effect of EGF on [3H]thymidine incorporation. The experimental conditions were as in the legend of Fig. 1. The serum-starved cells were incubated for the indicated periods with 2.5% FCS, or FCS plus 2.5 ng/ml EGF and labelled with [3H]thymidine for the last 2 h in culture. The results are the means of four cultures. Standard deviations are not indicated for the sake of clarity, but the differencies found for EGF-treated and EGF-untreated cultures are significant (Student `t' test) at 15 h and later times of incubation.Fig. 5Time course of [125I]EGF binding at room temperature. 90% confluent monolayers were incubated for 24 h in medium containing 0.2% FCS, then for 1 h at 37°C with PBS containin 0.2% BSA. The binding was performed at room temperature in the above binding buffer containing [125I]hrEGF (60 000 cpm in 1 ml) for the indicated times. After careful rinsing, the cells were lysed and the total bound radioactivity was determined with an LKB gamma counter. The results are means of 4 cultures. The standard deviations are not indicated for the sake of clarity.Fig. 6Receptor saturation curve and Scatchard analysis. Cells were incubated for 2 h with increasing concentrations of [125I]EGF as described in the legend of Fig. 5. The cells were carefully rinsed, and the total bound radioactivity was determined. Specific binding was determined by subtracting the binding measured in the presence of a 200-fold excess of unlabelled EGF from the total binding values. Inset shows the Scatchard plots of the binding data for AC in 1- and 14-month old rats.Fig. 7Autoradiographs of RT-PCR products amplified with oligonucleotide primers for EGF, EGF-receptor and GAPDH. Amplified PCR products were separated and analyzed as described in Section 2. They were hybridized with the corresponding oligonucleotide probe labelled with γ32P-ATP. The hybrids were revealed by autoradiography and films were scanned. 1 and 2: 1-month old; 3 and 4: 8-month old; 5 and 6: 14-month old rats. Upper row shows hybrids of gene-specific cDNA coding for EGF-proteins; third row shows hybrids of gene specific cDNA coding for EGF-receptor protein. Lanes 1, 3 and 5: the cells were not stimulated with EGF prior to extraction of RNA. Lanes 2, 4 and 6: the cells were stimulated for 24 h with 2.5 ng/ml EGF prior to extraction of RNA. GAPDH was used as an internal standard for amplification protocol.Fig. 8Graphic representation of the scans in Fig. 7. Columns represent the relative density of the bands expresed as per cent of the corresponding GAPDH band density. (A) Scans of the EGF, upper row in Fig. 7. (B) Scans of the EGF-receptor, third row in Fig. 7.Table 1(125I)EGF-receptor binding data*1-month old8-month old14-month oldKd (nM)0.180.120.07Bmax (M/μg DNA)5.04×10−119.21×10−122.61×10−12No. of receptors37 80016 7501950*The data are obtained by computer analysis of the results shown in Fig. 6.Age-related decrease in the responsiveness of rat articular chondrocytes to EGF is associated with diminished number and affinity for the ligand of cell surface binding sitesDidierRibaultMessaiHabibKhatibAbdel-MajidAlainBarbaraDragoslavMitrovic*INSERM U-349, 6 rue Guy Patin, 70510 Paris, France*Corresponding author. Tel.: +33 1 49956447; fax: +33 1 49958452.AbstractThe effect of age on the responsiveness of articular chondrocytes (AC) to epidermal growth factor (EGF) was examined. Cells were isolated by digesting cartilage fragments from the humeral and femoral heads of 21-day old, 8- and 14-month old rats with collagenase. The cells were cultured under standard conditions, as monolayers. DNA synthesis was measured by [3H]thymidine incorporation and cell proliferation by the DNA content of subconfluent cultures. [125I]EGF binding and the amounts of EGF and EGF-receptor mRNAs were determined using confluent cells. DNA synthesis was decreased with age of animals. EGF stimulated DNA synthesis in cultures in 1- and 8-month old rats at low serum concentrations (<5%), and in cultures in 14-month old animals at high serum concentrations. It also increased 5-day DNA content of cultures compared to serum-treated controls but this effect was weak in cultures in 14-month old rats. The number of high affinity binding sites for [125I]EGF decreased from 37 800 in the 1-month old to 1950 in the 14-month old rat AC. The apparent dissociation constant (Kd) also decreased with age: 0.18 nmol/l in the 1-month old; 0.12 nmol/l in the 8-month old; and 0.07 nmol/l in the 14-month old cells. AC in older rats contained more EGF mRNA and less EGF-receptor mRNA. Incubation of the cells with EGF resulted in down regulation of the EGF- and upregulation of EGF-receptor mRNA expressions. These findings show the age-related quantitative and qualitative alterations in EGF and EGF-receptor which may account, at least in part, for the diminished responsiveness of senescent AC to EGF.KeywordsAgingEpidermal growth factorRat articular chondrocytesDNA synthesisEGF-receptorEGF- and EGF-receptor mRNAs expressions1IntroductionCellular senescence in culture is associated with a gradual decline in mitotic activity, in which the number of population doublings is inversely proportional to the age of a donor (Hayflick and Moorhead 1961, Hayflick 1965, Martin et al. 1970, Schneider and Mitsui 1976, Golstein et al. 1978). This is usually interpreted as an expression of cellular aging (Norwood et al., 1990). The decline in the replicative capacity of senescent cells is usually attributed to the gradual increase in the fraction of cells arrested in the nonreplicative phase, near the G1/S boundary of the cell cycle, just before the onset of DNA synthesis (Rittling et al. 1986, Cristofallo 1988, Afshari et al. 1993). The failure of senescent cells to initiate DNA synthesis and replicate is associated with a diminished responsiveness to mitogenic stimuli such as growth factors including the epidermal growth factor (EGF) (Phillips et al. 1984, Ishigami et al. 1993, Tang et al. 1994, Li et al. 1995).There is good experimental evidence indicating that cellular senescence is controlled by an active dominant genetic programme (Rittling et al. 1986, Hensler and Pereira-Smith 1995, Goldstein 1990, Ning and Pereira-Smith 1991, Goletz et al. 1993, Doggett et al. 1992, Pang and Chen 1994) and that senescent cells no longer initiate the transcription of certain growth regulatory genes such as c-fos proto-oncogene (Seshadri and Campisi, 1990). Although, changes underlying the cellular senescence are still poorly understood, a good deal of evidence points to differences in gene expression in young and senescent cells (Rittling et al. 1986, Li et al. 1995, Doggett et al. 1992, Dereventzi et al. 1996, Tahara et al. 1995).EGF is a potent mitogen for many cells including chondrocytes (Vivien et al. 1990, Kinoshita et al. 1992, Ribault et al. 1997). This 53 amino acid polypeptide with a molecular weight of 6045 Da exerts its biological effects, only after it is bound to specific cell surface receptors. Once it is bound to its receptor, it activates the receptor's intracellular tyrosine kinase domain resulting in a phosphorylation of tyrosine residues and in the generation of a signal which initiates DNA synthesis, cell cycle progression, and cellular proliferation (Carpenter and Wahl, 1990). EGF extends the replicative life span and increases the saturation density of human diploid fibroblasts in vitro (Carpenter and Cohen 1976, Kaji and Matsuo 1983), but these effects decrease with cellular ageing in vitro. The unresponsiveness of senescent cells to EGF does not seem to be associated with quantitative or qualitative changes in the EGF-receptors (Phillips et al. 1984, Ishigami et al. 1993) or to EGF-induced activation of the receptor's tyrosine kinase domain (Gerhard et al., 1991). However, Tang et al. (1994)recently reported a decrease in EGF receptor mRNA expression in fibroblasts that had attained their maximal life span.EGF has occasionally been reported to have a mitogenic action in chondrocytes (Vivien et al. 1990, Kinoshita et al. 1992, Ribault et al. 1997), and these cells bear specific high and low affinity receptors (Kinoshita et al. 1992, Ribault et al. 1997). Although, to our knowledge, the effect of EGF on chondrocytes derived from young, mature and old donors has not been studied. We have therefore examined the effects to EGF on articular chondrocytes (AC), isolated from young, mature and old rats and measured its mitogenic action, the presence of specific binding sites, and the expression of EGF- and EGF receptor-specific mRNA.2Materials and methods2.1Cell cultureRat ACs were isolated from the humeral and femoral heads of 21-day old, 8- and 14-month old male Wistar rats (Charles River, France) (Ribault et al., 1997). Briefly, cartilage slices were digested at 37°C for 10 min (young) or 5 min (old) with 0.05% trypsin-3 mM EDTA solution (Eurobio, France) with gentle shaking to remove contaminant cells and cell debris. The chondrocytes were then released by incubation for 1–2 h (1-month old rats) and 10 min (older animals) with 0.1% bacterial collagenase (Type IA, Sigma, St. Louis, MO). The released cells were sedimented and washed by centrifugation (5 min at 450×g) with DMEM nutrient medium. The cells were seeded in 25 cm2 sterile plastic flasks at 2×106 cells and cultured under standard conditions (37°C, 95% humidified atmosphere, 5% CO2) in DMEM nutrient medium containing serum and antibiotics (100 IU/ml penicillin and 50 mg/ml streptomycin). The cells in young rats were cultured in the medium containing 10% fetal calf serum (FCS), and cells in old animals in serum containing 10% FCS and 10% horse serum.The confluent cells, 4–5 days after seeding, were detached by gentle shaking for 5–10 min with trypsin-EDTA solution. The isolated cells were collected and washed by centrifugation, and the suspended cells seeded in 24-well Falcon culture plates at 2×104 cells per well, or in culture flasks at 1×104 cells per cm2. First passage cells were used in all experiments. The culture medium was changed every 3–4 days.2.2DNA synthesis and cell proliferationDNA synthesis was monitored by measuring the incorporation of [3H]thymidine into nuclear DNA, and cell proliferation by measuring the DNA content (West et al., 1985) of the cultures. The cells were seeded and cultured under standard conditions in 24-well plates; the medium was replaced with DMEM containing 0.2% FCS on the 3rd day after seeding. This medium was removed the next day and cells were incubated for 24 h in medium containing 2.5% FCS and (except controls) indicated concentrations of human recombinant EGF (Genzyme). [3H]thymidine (1 μCi/ml, NEN) was added for the last 6 h of incubation.The labelled cell monolayers were washed with PBS, fixed in cold 5% TCA (2×15 min), then in cold 80% ethanol and lysed at 37°C for 2 h in 400 μl 10 mM EDTA, pH 12.3. The alkaline lysates were neutralized with 20 μl 1 M KH2PO4 and 200 μl samples, were counted in a liquid scintillation counter (LKB Wallac 1409). The neutralized alkaline digests were also used to measure the DNA content of the cultures. The results are expressed as the means of at least four cultures±1 S.D. and were compared with controls using Student's `t' test.2.3[125]EGF bindingBinding studies were performed using 90% confluent AC cultured in 24-well plates (Ribault et al., 1997). In order to block the non-specific binding sites, serum-starved cell monolayers were pre-incubated for 1 h at 37°C degree in PBS plus 0.2% bovine serum albumin (BSA) and then 60 000 cpm of the human recombinant [125I]EGF (900 Ci/mmol, Amersham) were added per ml of the binding buffer. Preliminary experiments showed that [125I]EGF binding reached a plateau in less than 2 h at room temperature. Cells were then washed three times with the binding buffer, lysed with 1 ml 1 N NaOH, and the lysates counted in an LKB γ-counter.Saturation curves were obtained at room temperature by incubating cell monolayers for 2 h in the binding buffer containing increasing concentrations of [125I]EGF. Displacing curves were obtained similarly in the presence of [125I]EGF (60 000 cpm/ml of binding buffer) and increasing concentrations of unlabelled EGF. Non-specific binding was determined by subtracting the [125I]EGF binding obtained in the presence of 200-fold excess of unlabelled EGF from the corresponding total binding data.2.4RNA isolationTotal cellular RNA was isolated from 90% confluent rat AC monolayers subcultured in 75 cm2 flasks. The serum-starved cells were incubated for 24 h without or with 2.5 ng/ml EGF in the presence of 2.5% FCS as described above for DNA synthesis prior to RNA extraction. The cell monolayers were then rinsed with PBS and total RNA isolated using the Rapid RNA™ purification kit (Amresco, USA). RNA pellets were collected by centrifugation (10 min, 4°C, 15 000×g), air dried, and resuspended in 100 μl sterile diethylpyrocarbonate-treated water. The concentration and purity of the total cellular RNA were determined by spectrophotometry at 260, 280 and 230 nm.2.5Oligonucleotide primer design and RT-PCRThe oligonucleotide primers used for RT-PCR were designed from published cDNA sequences Saggi et al. 1992, Avivi et al. 1991, Tso et al. 1985and were synthesized by Genosis Biotechnologies (England). The sense and antisense primers in the 5′, 3′ direction were: for EGF, sense position 3033–3056 (GCTCAGACTGTCCTCCCACCTCG), antisense position 3482–3460 (CCCGTAGTCAGCATGGCGCAGC) (Saggi et al., 1992); for EGF-receptor sense position 1260–1282 (GGACCTTCACATCCTGCCAGTG), antisense position 1870–1848 (GGTGATGTTCATGGCCTGGGGC) (Avivi et al., 1991); for glyceraldehyde-3-phosphate dehydrogenase (GAPDH), sense position 260–280 (TGCTGGTGCTGAGTATGTCG), anti-sense position 907–888 (ATTGAGAGCAATGCCAGCC) (Tso et al., 1985). These gave PCR products of 449 base pairs for EGF, 610 base pairs for EGF-receptor and 646 base pairs for GAPDH. Reverse transcription and PCR amplification were performed as described elsewhere (Ribault et al., 1997) with modifications. In the preliminary experiments, it was established that linear concentration-related RT-PCR amplifications were achieved with 2.5 μg RNA and 30 cycles for EGF, with 1.5 μg RNA and 25 cycles for EGF-receptor. GAPDH was amplified under the same conditions as each of the above genes. Genomic contamination was checked by monitoring amplification in the absence of MMLV-reverse transcriptase after digestion of 4 μg RNA by RNAase A (10 mg/ml) for 1 h at 37°C.2.6Analysis of RT-PCR productsThe PCR products were analyzed by agarose (2%) gel electrophoresis in Tris–borate–EDTA buffer (89.2 mM Tris, 89 mM boric acid, 0.05 mM EDTA pH 8.3) containing 0.1 μg/ml ethidium bromide, for 1 h at 20°C at 10 V/cm. The DNA bands, stained with ethidium bromide, were visualized and photographed under UV light using positive/negative instant film (Polaroid Kodak). DNA molecular weight markers (marker VI from Boehringer) were used to determine the sizes of the amplified products.All PCR products were transferred to nylon sheets and hybridized with synthetic oligonucleotide probes labelled with γ32P-ATP (10 mCi/ml, NEN) by T4 polynucleotide kinase (ATGC, USA). These probes were designed from published sequences and recognized a unique sequence located between the PCR primer templates. The sequences of oligonucleotides were: for EGF (5′GCCCATCAGCACCTGGACTGCC3′), spanning nucleotides 3227 and 3249; for EGF-receptor (5′GTGAGCAGAGGCAGGGAGTGCG3′), spanning nucleotides 1744 and1766; and for GAPDH (5′CATGGACTGTGGTCATGAGC3′), spanning nucleotides 512 and 532. The hybrids were revealed by autoradiography using Hyper film MP (Amersham). The films and membranes were exposed for 1–2 h at −80°C and then processed routinely. The radioactive bands wee analyzed by scanning densitometry.3Experimental resultsAt serum concentration of 2.5%, EGF induced a concentration-dependent increase in [3H]thymidine incorporation by AC in all three age groups of rats (Fig. 1). The AC in 1-month old animals responded much better than cells in 8-month old and 8-month old animals responded much better than cells in 14-month old animals. The effect was highly significant at 0.25 ng/ml of EGF. In all cultures maximal stimulation was attained with 1 ng/ml, but the effect decreased significantly at 10 ng/ml in cultures in 1- and 8-month old rats. The response of AC in young and old rats also differed with respect to FCS concentration (Fig. 2). AC in 1-month old rats responded to EGF maximally at low serum concentration (<2.5%). The effect decreased gradually at higher serum concentration (≥5%) and completely disappeared at 10% FCS (Fig. 2a). The cells in 8-month old animals responded better at low serum concentration and were relatively insensitive at high serum concentration (Fig. 2b). In contrast, AC in 14-month old rats were poorly stimulated by EGF at low serum concentration and responded much better to the factor at higher (≥2.5%) serum concentration (Fig. 2c). The effects of FCS or FCS plus 2.5 ng/ml EGF on cell proliferation are shown in Fig. 3. The DNA content of all cultures increased as a function of serum concentration, but much more in cultures in 1-month old animals. The exposure of cells for 5 days to 2.5 ng/ml EGF, resulted in an increase of the DNA content which was consistently higher than in cultures lacking EGF. FCS (1%) increased the DNA content of cultures in 1-month old rats by a factor of 1.83, whereas similar increase was achieved at 5% FCS in a 8-month old cultures. In the range of serum concentrations tested, DNA content of cultures in 14-month old rats was much less affected by EGF. Growth-arrested AC incubated with FCS or FCS and EGF, did not incorporate [3H]thymidine during the 12–15 h after the stimulus had been given (Fig. 4). Only a small fraction of cells initiated DNA synthesis at 15 h and a somewhat larger fraction after 18 h of stimulation. Again, a significantly larger proportion of AC in 1-month old rats incorporated [3H]thymidine at and after 15 h of stimulation compared to the cells derived from old rats.The time course of [125I]EGF binding at 20°C to cell monolayers is shown in Fig. 5. There was much less [125I]EGF binding per μg DNA by AC in 14-month old rats, although binding (plateau) was saturated earlier (45 min) than for the younger cells (120 min). An incubation time of 2 h was therefore used in subsequent binding experiments.Total, specific and non-specific bindings and the corresponding Scatchard plots are shown in Fig. 6. The specific binding was more than 80% of the total binding in all three types of culture and Scatchard plot analysis of the binding data indicated the presence of a single class of high affinity binding sites, only. Table 1 summarizes the binding data as obtained by computer analysis. As it is apparent, the binding affinity (Kd) decreased with age of cells from 0.18 nM for the 1-month old to 0.07 nM for the 14-month old cells. The maximal binding (Bmax) also decreased from 5.04×10−11–2.61×10−12 mol/μg DNA for the AC in old rats. There were 37 800, 8900 and 1950 binding sites per cell for cultures derived from 1-, 8- and 14-month old rats, respectively.The mRNAs for EGF and the EGF-receptor in unstimulated and EGF-stimulated rat AC were revealed by RT-PCR of the total extracted RNA. The amplified cDNA products were separated by agarose gel electrophoresis and stained with ethidium bromide. The products migrated in the gel at the positions predicted from the respective cDNA sequences 449 bp for EGF, and 610 bp for the EGF-receptor.The PCR products were transferred to nylon membranes and hybridized with γ32P-labelled specific oligonucleotides. cDNA fragments of 449 and 610 bp interacted with the respective probes (Fig. 7). It is apparent that AC in 8- (lanes 3 and 4) and 14- (lanes 5 and 6) month old rats contain more EGF mRNA and less EGF-receptor mRNA (lanes 1, 3 and 5). EGF stimulation also decreased the amount of mRNA transcripts specific for EGF, and increased that of EGF-receptor mRNA in all three types of cells (lanes 2, 4 and 6). Fig. 8 shows densitometric semi-quantitative analysis of the scans of the Fig. 7.4Discussion and conclusionsThese results show several age-related alterations in chondrocytes derived from the articular cartilage of adult rats. The cells from mature and aged rats have a decreased proliferative capacity and responsiveness to EGF. The concentration of EGF needed to stimulate DNA synthesis was about the same for young and old cells, but considerably less DNA was synthesized by old cells. EGF initiated DNA synthesis more effectively in young cells at a low serum concentration, but worked best at a higher serum concentration in old cells. EGF increased the DNA content of cultures at all the serum concentrations studied. The induction of DNA synthesis following growth arrest starts approximately 18 h after the cells have been challenged with FCS or FCS plus EGF. EGF does not shorten this time lag but it does increase the number of cells that initiate DNA synthesis. Assuming that each dividing cell incorporates the same amount of [3H]thymidine, the fraction of cells that enter the S phase of the cell cycle is always much greater in cultures from young animals and in those exposed to EGF.It has been reported that the responsiveness of cells to growth factors, including EGF, and the number of cell divisions in vitro diminish with the age of the cell donor (Gospodarowicz and Meschern 1977, Dominice et al. 1986, Chen et al. 1990, Colige et al. 1990, Matsuda et al. 1992, Ishigami et al. 1993, Tang et al. 1994, Li et al. 1995). The diminished proliferative capacity of senescent cells is associated with a gradual loss of cell responsiveness to growth factors like EGF. This could be ascribed to quantitative and/or qualitative changes in specific receptors, but the published findings on this point are not unanimous. Some studies found no significant age-related changes in the density or binding affinity of EGF-specific receptor (Phillips et al. 1983, Ishigami et al. 1993). However, other studies have reported fewer EGF-receptors in cells from older donors (Carlin et al. 1983, Matsuda et al. 1992, Marti 1993).Our results also indicate that a decrease in the number and binding affinity of EGF receptors can account for the lower responsiveness of senescent rat AC to EGF. The number of EGF receptors and their binding affinity were dramatically decreased in cells isolated from old rats. The number of binding sites dropped from 37 800 in cells in 1-month old to 1950 in those in 14-month old rats. The Kd value decreased similarly from 0.18 to 0.07 nmol/l.The reasons for these discrepancies are not known, but differences in the methods used may be important. It is intriguing that no evidence for receptor alteration have been reported in studies of cell senescence in vitro (Carlin et al. 1983, Gerhard et al. 1991, Ishigami et al. 1993), whereas alteration are seen in cells derived from donors of different ages (Matsuda et al. 1992, Marti 1993). However, the lower responsiveness of senescent AC to growth factors may also be associated with an increased number and unchanged affinity for the ligand of the specific binding sites as we have obtained for insulin like growth factor 1 (not shown).In agreement with the binding study results, there were also age-related differences in the EGF and EGF-receptor mRNA expressions. Decreased EGF-receptor mRNA expression in cells from older animals supports the binding data. Surprisingly, we also found that the amount of EGF mRNA is increased in old cells and that EGF modulates the expression of both EGF and EGF-receptor mRNAs. The modulation of the expression of the EGF-receptor mRNA by EGF is observed in several studies, independently of age (Clark et al., 1985). The significance of these findings is unclear. The feed-back mechanism could be put forward to explain an over expression of EGF mRNA in senescent cells where the number of receptors also decreases. Many different mechanisms could alter the amounts of receptor in senescent cells. For instance, mRNA stability, translational efficiency, rates of synthesis, post-translational modifications and the turnover of the EGF-receptor. Several other abnormalities are associated with cellular aging, in addition to the changes in the receptor density and affinity. There is transcriptional repression of several growth regulatory genes such as c-fos in senescent human fibroblasts (Seshadri and Campisi, 1990), gas-1 and gas-6 in senescent murine fibroblasts Cowled et al., 1994, a post-transcriptional block of proliferative cell nuclear antigen (PCNA) (Chang et al., 1991) and a translational defect in ornithine decarboxylase (Seshadri and Campisi, 1990). Other genes, which products inhibit cell proliferation, are in contrast expressed or over expressed in senescent cells. These include p 21(sdi 1/cip 1/waf 1) which blocks kinase activity of Cdks (Tahara et al., 1995) and interacts with PCNA (Waga et al., 1994), prohibit, interleukin-1α (a potent inhibitor of cell proliferation), bcl-2 which is associated with apoptosis (Dereventzi et al., 1996) and others.Future investigations, on the aging of AC will concentrate on the age-related changes in gene expression that may be induced by EGF in vitro.ReferencesAfshari et al., 1993C.A.AfshariP.J.VojtaL.A.AnnabP.A.FrutrealT.B.WillardJ.C.BarrettInvestigation of the role of G1/S cell cycle mediators in cellular senescenceExp. Cell Res.2091993231237Avivi et al., 1991A.AviviI.LaxA.UlrichJ.SchlessingerD.GivolB.MorseComparison of EGF receptor sequences as a guide to study the ligand binding siteOncogene61991673676Carlin et al., 1983C.R.CarlinP.PhillipsB.KnowlesV.J.CristofaloDiminished in vitro tyrosine kinase activity of the EGF receptor of senescent human fibroblastsNature3061983617620Carpenter and Cohen, 1976G.CarpenterS.CohenHuman epidermal growth factor and the proliferation of human fibroblastsJ. Cell. Physiol.881976227237Carpenter and Wahl, 1990Carpenter, G., Wahl, M.I., 1990. The epidermal growth family. In: Sporn, M.B., Roberts, A.B. (Eds.), Peptide Growth Factor and Their Receptors. Springer-Verlag, New York, pp. 69–171.Chang et al., 1991C.D.ChangP.PhillipsK.E.LipsonV.J.CristofaloR.BasergaSenescent human fibroblasts have a post-transcriptional block in the expression of the proliferating cell nuclear antigen geneJ. Biol. Chem.256199186638666Chen et al., 1990J.J.ChenN.BrotH.WeissbachRNA and protein synthesis in cultured human fibroblasts derived from donors of various agesMech. Ageing and Dev.131990285295Clark et al., 1985A.J.ClarkS.IshiiN.RichertG.T.MerlinoI.PastanEpidermal growth factor regulates the expression of its own receptorProc. Natl. Acad. Sci. USA82198583748378Colige et al., 1990A.ColigeB.NusgenC.M.LapiereResponse to epidermal growth factor of skin fibroblasts from donors of varying age is modulated by extracellular matrixJ. Cell. Physiol.1451990450457Cowled et al., 1994P.A.CowledC.CiccareliE.CocciaL.PhilipsonV.SorrentinoExpression of growth arrest-specific (gas) genes in senescent murine cellsExp. Cell Res.2111994197202Cristofallo, 1988V.J.CristofalloThe regulation of cell senescenceProc. Am. Philos. Soc.1321988140147Dereventzi et al., 1996A.DereventziS.I.S.RatanE.S.GonosMolecular links between cellular mortality and immortality (review)Anticancer Res.16199629012910Doggett et al., 1992D.L.DoggettM.O.RotenbergR.J.PignoloP.D.PhillipsV.J.CristofaloDifferential gene expression between young and senescent, quiescent WI-38 cellsMech. Ageing Dev.651992239255Dominice et al., 1986J.DominiceC.LevasseurS.LarnoX.RonotM.AdolpheAge-related changes in rabbit articular chondrocytesMech. Ageing Dev.371986231240Gerhard et al., 1991G.S.GerhardP.D.PhillipsV.J.CristofaloEGF- and PDGF-stimulated phosphorylation in young and senescent WI-38 cellsExp. Cell Res.19319918792Goldstein, 1990S.GoldsteinReplicative senescence: the human fibroblast comes of ageScience249199011291133Goletz et al., 1993T.J.GoletzP.J.HenslerY.NingC.R.AdamiP.M.Pereira-SmithEvidence for a genetic basis for the model system of cellular senescenceJ. Am. Geriatr. Soc.41199312551258Golstein et al., 1978S.GolsteinE.L.MoermanJ.S.SoeldnerR.E.GleasonD.M.BarnettChronologic and physiologic age affect replicative life span of fibroblasts from diabetic, prediabetic, and normal donorsScience1991978781782Gospodarowicz and Meschern, 1977D.GospodarowiczA.L.MeschernA comparison of the responses of cultured myoblasts and chondrocytes to fibroblast and epidermal growth factorJ. Cell. Physiol.931977117128Hayflick, 1965L.HayflickThe limited in vitro life-time of human diploid cell strainExp. Cell Res.371965614636Hayflick and Moorhead, 1961L.HayflickP.S.MoorheadThe serial cultivation of human diploid cell strainsExp. Cell Res.251961585621Hensler and Pereira-Smith, 1995P.J.HenslerO.M.Pereira-SmithHuman replicative senescence. A molecular studyAm. J. Pathol.147199518Ishigami et al., 1993A.IshigamiT.D.ReedG.S.RothEffect of aging on EGF stimulated DNA synthesis and EGF receptor levels in primary cultured rat hepatocytesBiochem. Biophys. Res. Commun.1961993181186Kaji and Matsuo, 1983K.KajiM.MatsuoResponsiveness of human lung diploid fibroblast during aging in vitro to epidermal growth factor: saturation density and lifespanMech. Ageing Dev.221983129133Kinoshita et al., 1992A.KinoshitaM.TakigawaF.SuzukiDemonstration of receptors for epidermal growth factor on cultured rabbit chondrocytes and regulation of their expression by various growth and differentiation factorsBiochem. Biophys. Res. Commun.18319921420Li et al., 1995J.LiZ.ZhangT.TongThe proliferative response and anti-oncogen expression in old 2 BS cells after growth factor stimulationMech. Ageing Dev.8019952534Marti, 1993U.MartiHandling of epidermal growth factor and number of epidermal growth factor receptors are changed in aged male ratsHepatology18199314321436Martin et al., 1970G.M.MartinC.A.SpragueC.J.EpsteinReplicative life-span of cultivated human cellsLab. Invest.2319708692Matsuda et al., 1992T.MatsudaK.OkamuraY.SatoA.MorimotM.OnoK.KohnoM.KuwanoDecreased response to epidermal growth factor during cellular senescence in cultured human microvascular endothelial cellsJ. Cell. Physiol.1501992510516Ning and Pereira-Smith, 1991Y.NingO.M.Pereira-SmithMolecular genetic approaches to the study of cellular senescenceMutat. Res.2561991303310Norwood et al., 1990Norwood, T.H., Smith, J.R., Stein, G.H., 1990. Aging at the cellular level: the human fibroblast-like cell model. In: Schneider, E.L., Rowe, J.W. (Eds.), Hand. Biol. Aging, 3rd ed. San Diego, CA, pp. 131–154.Pang and Chen, 1994J.H.PangK.Y.ChenGlobal change of gene expression at late G1/S boundary may occur in human IMR90 diploid fibroblasts during senescenceJ. Cell. Physiol.1601994531538Phillips et al., 1983P.D.PhillipsE.KuhnleV.J.Cristofalo[125I]EGF binding ability is stable through the replicative life span of WI-38 cellsJ. Cell. Physiol.1141983311316Phillips et al., 1984P.D.PhillipsK.KajiV.J.CristofaloProgressive loss of the proliferative response of senescing WI-38 cells to platelet-derived growth factor, epidermal growth factor, insulin, transferrin, and dexamethasoneJ. Gerontol.3919841117Ribault et al., 1997D.RibaultA.M.KhatibA.PanasuykA.BarbaraZ.BouizarR.D.MitrovicMitogenic and metabolic actions of epidermal growth factor on rat articular chondrocytes: modulation by fetal calf serum, transforming growth factor-β, and tyrphostinArch. Biochem. Biophys.3371997149158Rittling et al., 1986S.R.RittlingK.M.BrooksV.J.CristofaloR.BasergaExpression of cell cycle-dependent genes in young and senescent WI-38 fibroblastsProc. Natl. Acad. Sci. USA83198633163320Saggi et al., 1992S.J.SaggiR.SafirsteinP.M.PriceCloning and sequencing of the rat preproepidermal growth factor cDNA: comparison with mouse and human sequencesDNA Cell Biol.111992481487Schneider and Mitsui, 1976E.L.SchneiderY.MitsuiThe relationship between in vitro cellular ageing and in vivo human ageProc. Natl. Acad. Sci. USA73197635843588Seshadri and Campisi, 1990T.SeshadriJ.CampisiRepression of c-fos transcription and an altered genetic program in senescent human fibroblastsScience2471990205209Tahara et al., 1995H.TaharaE.SatoA.NodaT.IdeIncrease in expression level of p21sdi 1/cip1/waf1 with increasing division age in both normal and SV 40-transformed human fibroblastsOncogene101995835840Tang et al., 1994Z.TangZ.ZongyuY.ZhengM.J.CorbleyT.TongCell aging of human diploid fibroblasts is associated with changes in responsiveness to epidermal growth factor and changes in HER-2 expressionMech. Ageing Dev.7319945767Tso et al., 1985J.Y.TsoX.H.SunT.H.KaoK.S.ReeceR.WuIsolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNA: genomic complexity and molecular evolution of the geneNucleic Acids Res.13198524852502Vivien et al., 1990D.VivienP.GaleraE.LebrunG.LoyauJ.P.PujolDifferential effects of transforming growth factor-β and epidermal growth factor on the cell cycle of rabbit articular chondrocytesJ. Cell. Physiol.1431990534545Waga et al., 1994S.WagaG.J.HannonD.BeachB.StillmanThe p21 inhibitor of cycline-dependent kinases controls DNA replication by interaction with PCNANature3691994574578West et al., 1985D.C.WestA.SattarS.KumarA simplified in situ solubilisation procedure for the determination of DNA and cell number in tissue cultured mammalian cellsAnal. Biochem.1471985289295