Experimental Gerontology 34 (1999) 275–287

Proliferative disorders of the aging human prostate:
Involvement of protein hormones and their receptors
G. Untergassera, H. Rumpolda, M. Hermanna, S. Dirnhofera, G. Jilgb,
P. Bergera,*
a

Institute for Biomedical Aging Research of the Austrian Academy of Sciences
Rennweg 10, A-6020, Innsbruck, Austria
b
Department of Urology, General Hospital, Hall, Austria
Manuscript received July 30, 1998; manuscript accepted October 12, 1998

Abstract
The majority of elderly men is affected by benign and malignant diseases of the prostate. Both
proliferative disorders, i.e., benign hyperplasia of the prostate (BPH) and prostate cancer
(PCa)—which has recently emerged as the most common male malignancy in industrialized
countries—seem to be governed by endocrine factors such as sex steroid hormones, but
auto/paracrine factors are involved as well. Age-related changes in levels and ratios of endocrine
factors as androgens, estrogens, gonadotropins, and prolactin (PRL) and changes in the balance
between auto/paracrine growth-stimulatory and growth-inhibitory factors such as insulin-like
growth factors (IGFs), epidermal growth factor (EGF), nerve growth factor (NGF), IGF-binding
proteins (IGFBPs), and transforming growth factor ␤ (TGF␤) are meant to be responsible for
abnormal prostatic growth. We investigated the existence of putative local regulatory circuits
involving the protein hormones, human growth hormone (hGH), human placental lactogen (hPL),
and hPRL, and their corresponding receptors in prostatic tissue specimens (transurethral resections
of the prostate, TURP; n ϭ 11), in the prostatic cancer cell lines PC3, Du145, LnCap, a
virus-transformed BPH cell line (BPH-1), and in a normal healthy prostate by RT-PCRs and
highly specific and sensitive immunofluorometric assays (IFMA). Neither hPRL nor hGH was
detected at the mRNA or protein levels in prostatic tissue and cell lines, with the exception of 2 of
11 prostatic TURP-samples, which showed weak expression of the PL-A/B genes. PRL- and
GH-receptors were expressed in all normal and pathological prostatic specimens. Surprisingly,

* Corresponding author. Peter Berger, PhD, Institute for Biomedical Aging Research, Austrian Academy of
Sciences, Rennweg 10, A-6020 Innsbruck, Austria. Tel: ϩ43-512-583919-24; Fax: ϩ43-512-583919-8; E-mail:
peter.berger@oeaw.ac.at
0531-5565/99/$–see front matter © 1999 Elsevier Science Inc. All rights reserved.
PII: S 0 5 3 1 - 5 5 6 5 ( 9 8 ) 0 0 0 6 3 - 1

276

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

PRL-receptor expression was not detectable in prostatic cancer cell lines. The trophic effects of
exogenous hGH, hPL, and hPRL were investigated by cell proliferation assays (WST-1) in
prostatic primary cell cultures and PCa cell lines. hGH significantly ( p Ͻ 0.005) increased cell
proliferation up to 138 Ϯ 3.2% (1 nM hGH), while hPL and hPRL revealed only moderate effects.
Our data suggest that local auto/paracrine networks of protein hormone actions are not involved in
the pathology of BPH or prostatic cancer. On the other hand, systemic pituitary-derived hGH can
increase the proliferative response of BPH and PCa, acting directly on the target organ prostate,
via the hGH-R. In this case, envisaged GH substitution in elderly people must be viewed at with
caution because age-related declines in GH/IGF-I could act as a protective mechanism against
abnormal cell growth. © 1999 Elsevier Science Inc. All rights reserved.
Keywords: Growth hormone; Prolactin; Placental lactogen; Benign prostatic hyperplasia; Prostate cancer

Enlargement of the aging prostate affects one of every two men over 50 years of age and
more than 95% of the male population after 70 years of age (Berry et al., 1984; Glyn et al.,
1985). The development of this benign prostatic hyperplasia (BPH) during senescence is
correlated to alterations in the endocrine status. In contrast to age-related decreases of free
testosterone (Vermeulen, 1991), pituitary-derived GH (Veldhuis and Leim, 1995) and,
consequently, hepatic IGF-I (Juul et al., 1994), an increase of gonadotropins, i.e., luteinizing
hormone (LH) and follicle stimulating hormone (FSH) (Neaves et al., 1984; Madersbacher
et al., 1993) and PRL (Vekemans and Robyn, 1975) can be observed in elderly men. In
addition to systemic endocrine changes, local changes of growth factors and hormones also
seem to be involved in the development of BPH (Byrne et al., 1996; Culig et al., 1996;
Griffiths, 1996; Dirnhofer et al., 1998).
Stromal– epithelial interactions via steroid hormones (androgens, estrogens) and growthstimulatory factors such as insulin-like growth factors (IGFs), epidermal growth factor
(EGF), nerve growth factor (NGF), keratinocyte growth factor (KGF), and fibroblast growth
factors (FGFs), as well as growth-inhibitory factors as transforming growth factor ␤ (TGF␤)
and IGF-binding proteins (IGFBPs) (Rajah et al., 1997) play an essential role in regulating
prostatic growth during embryonic and pubertal development and differentiation (Griffiths,
1996). After pubertal maturation, prostate homeostasis is mainly achieved by a balance
between growth-inhibitory and -stimulatory factors (Fig. 1). With aging, a disturbance of this
balance leads to abnormal prostatic growth and BPH. Which endocrine or local hormonal
factors induce this imbalance is still a matter of debate. There are several possibilities,
including increased availability of local prostatic estrogens (Krieg et al., 1993) or overexpression of ectopically produced growth factors (Dirnhofer et al., 1998).
Recently, it has been shown that transgenic mice overexpressing the rat PRL gene develop
dramatic enlargements of the prostate gland (Wennbo et al., 1997). Transgenic bovine GH
mice presented increased prostatic sizes, due to elevated IGF-I levels (Wennbo et al., 1997).
Interestingly, young patients with untreated acromegaly show a remarkable increase in
prostatic diameter and volume and a higher prevalence of micro- and macrocalifications
compared to healthy subjects (Colao et al., 1998). Thus, a possible involvement of protein
hormones in growth regulation of the prostate is conceivable.

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

277

Fig. 1. Growth-inhibitory factors such as transforming growth factor ␤ (TGF-␤), insulin-like growth factor
binding proteins (IGFBPs), or glycoprotein hormone ␣ (unpublished data), and growth-stimulating factors, such
as epidermal growth factor (EGF), insulin-like growth factors (IGFs), and keratinocytes/fibroblast growth factors
(KGF/FGF) are involved in the local growth regulation of the human prostate. These two types of factors provide
a balance apparently regulated by systemic factors, such as androgens, estrogens, and pituitary-derived hormones
as prolactin (PRL), growth hormone (GH), and gonadotropins. As a consequence of aging, the altered systemic
or local hormonal situation leads to an imbalance favoring growth-stimulatory factors, which ultimately leads to
the benign growth of the human prostate (BPH).

The aim of this study was to analyze endocrine and local prostatic networks, including
human (h) protein hormones, because hGH, hPL, and hPRL are potentially involved in
aberrant prostatic growth. Coexpression of GH- and PRL-receptors and the respective
ligands in prostatic tissue was investigated, and possible systemic or auto/paracrine functions
of these somatotrophic hormones elucidated by studying proliferative effects on human
BPH/PCa primary cultures and human prostate carcinoma cell lines Du 145, PC3, LnCap,
and BPH-1.

1. Materials and methods
1.1. Tissues and RNA isolation
BPH (n ϭ 5) and PCa-tissue (n ϭ 2) collected from transurethral resections of the
prostate (TURP; n ϭ 7; age range: 58 – 84 years), a prostate biopsy (45 years), Du145, PC3,
LnCap prostatic carcinoma cells (obtained from the American Type Culture Collection,
Rockville, MD), BPH-1 cells (obtained from the German Collection of Microorganisms and
Tissue Cultures, Braunschweig, Germany), and a human term placenta were snap frozen in
liquid nitrogen and kept at Ϫ70°C until use for RNA extraction and analysis by the
reverse-transcription polymerase chain reaction (RT-PCR). Written informed consent was
obtained from all patients before surgery. Peripheral blood mononuclear cells (PBMCs) were
obtained from healthy subjects (n ϭ 4) by Ficoll/Hypaque gradient centrifugation, as
described elsewhere (Boyum, 1968).

278

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

Total RNA was extracted from 100 mg of homogenized tissue (Ultra-Turrax, Janke &
Kunkel, Germany) or 5 ϫ 106 cells by the single-step acid guanidinium thiocyanate
phenol/chloroform method of Chomczynski and Sacchi (Chomczynski and Sacchi, 1987).
Integrity of RNA was assessed by analysis of 28S and 18S rRNA on ethidium bromidestained 1% agarose gels.
1.2. Cytosolic extracts
One hundred milligrams of BPH (n ϭ 4) and PCa (n ϭ 3) tissue specimen (TURP; n ϭ
7; age range: 61–75 years) or 5 ϫ 106 prostatic carcinoma cells or PBMCs were homogenized on ice in 1 mL PBS (Ultra-Turrax, Janke & Kunkel, Stauffen, Germany). Phenylmethane–sulfonyl fluoride and aprotinin (Merck, Darmstadt, Germany) were added as
protease inhibitor (1 mM). After centrifugation (10,000 ϫ g, 20 min, 4°C), the aqueous
cytosolic extract was stored at Ϫ20°C until analyses for hGH/hPRL/hPL content by immunofluorometric assays (IFMA).
1.3. Prostatic cell cultures
Two hundred milligrams of TURP tissue were cut into to small pieces with a sterile razor
and digested with 50 mg collagenase (Sigma-Aldrich, Milwaukee, WI) in 20 mL RPMI 1640
(BioWhittaker, Boehringer-Ingelheim, Belgium) medium without fetal calf serum (FCS) for
two hours at 37°C in a head-over-head shaker. The cell suspensions were centrifuged at
250 ϫ g for 5 min, and cell pellets resuspended in 20 mL fresh RPMI 1640 containing 10%
FCS. After five days attached cells were passaged twice to obtain adequate amounts of cells,
which in their vast majority are of stromal origin.
1.4. Reverse transcriptase polymerase chain reaction (RT-PCR)
Extreme care was taken to avoid specimen contamination during RNA extraction and
RT-PCR. Filtered pipette tips (Biorad, Richmond, CA) were used, and mock-transcribed
RNA from each cDNA sample served as control for contamination in the RT-PCR reaction.
One microgram of total RNA was diluted in 10 ␮L Diethylpyrocarbonate (DEPC,
Sigma-Aldrich) water in a 0.5-mL PCR tube (Perkin-Elmer Cetus, Norwalk, CT), denatured
at 65°C for 10 min in a programmable thermal cycler (TC; Techne, Cambridge, UK), rapidly
cooled to 4°C, and reverse transcription performed in a final volume of 50 ␮L under the
following reaction conditions: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM
DTT, 1 mM each of dATP, dCTP, dGTP, and dTTP (Promega, Madison, WI), 10 U human
placental ribonuclease inhibitor (Promega), 200 pmol random hexamer oligonucleotide
(Boehringer-Mannheim, Germany), and 50 U MMLV-Reverse Transcriptase (Promega). The
reaction mix was incubated for eight minutes at 20°C and eight minutes at 25°C to achieve
optimal hybridization between the RNA and the hexamer primers. The reverse transcriptase
was then allowed to proceed at 37°C for 30 min.
Five microliters (100 ng) of cDNA were used for PCR amplification in a final volume of
25 ␮L under the following conditions: 10 mM Tris-HCl (pH 9), 50 mM KCl, 1.5 mM MgCl2,

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

279

Table 1
Primer sequences, primer localization, cDNA fragment lengths and annealing temperatures used for RT-PCR
Primer

Sequence 5Ј-3Ј

Localization

cDNA Fragment

Annealing Temp.

PRL-R 5Ј
PRL-R 3Ј
GH-R 5Ј
GH-R 3Ј
GH/PL 5Ј
GH/PL 3Ј
PRL 5Ј
PRL-3Ј
LDL-R 5Ј
LDL-R 3Ј

ACTTACATAGTTCAGCCAGAC
TGAATGAAGGTCGCTGGACTCC
GGTATGGATCTCTGGCAGCTG
GGAGGGCAATGGGTGGATCTG
CACTCAGGGTCCTGTGGACAG
ACAGAGCGGCACTGCACGATG
GGGTTCATTACCAAGGCCATC
TTCAGGATGAACCTGGCTGAC
CAATGTCTCACCAAGCTCTG
TCTGTCTCGAGGGGTAGCTG

363–384
652–673
41–62
489–509
(Ϫ)35-(Ϫ)14
620–631
228–249
483–504
n.d.
n.d.

310 bp

55°C

468 bp/402 bp

59°C

666 bp

63°C

276 bp

55°C

258 bp

57°C

Localization referred to the start codon of the cDNA sequence encoding for th protein: PRL-R, Boutin et al.,
1989; PRL, Cooke et al., 1981; GH/PL, Chen et al., 1989; GH-R, Leung et al., 1987.
Due to their location in highly conserved regions of exon 1 and exon 5 the GH/PL primer pair amplifies mRNAs
from all five GH and PL genes (GH-N, GH-V, PL-A, PL-B, PL-L). In addition to the full length transcripts,
potential alternatively spliced products can also be detected. GH-N/V and PL-A/B transcripts were distinguished
by digestion with Rsa I (GH-N/V) and Xba I (PL-A/B).
n.d.: not determined.

0.1% Triton X-100, 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 4 pmol each of the two
oligonucleotide primers specific for each gene-product (PRL, GH/PL, GH-R, PRL-R; Table
1), and 0.125 U Taq polymerase (Promega). After initial denaturation for two minutes at
95°C, 35 amplification cycles were performed. PCR products were run on a 2% agarose gel
containing 4 ␮g/100 mL ethidiumbromide at 60 V/100 mA for two hours and visualized and
photographed under UV light.
1.5. Immunofluorometric assays (IFMAs) for hPL-A/B, hGH-N, and hPRL
Specific IFMAs for pituitary-derived hGH-N and hPRL and hPL-A/B were established
based on our own panel of well-characterized monoclonal antibodies (MCA) as described
previously (Untergasser et al., 1997). IFMA technology provided the highest sensitivity and
widest measuring range, and were performed in analogy to our assays for glycoprotein
hormones (Madersbacher et al., 1993). hPRL 81/541, hGH 66/217 (NIBSB, South Mimms,
UK), and hPL (NIDDK, Bethesda, MD) were used as hormone standard preparations.
Briefly, 10 ␮g of highly purified MCA, coded as INN-hPL-37, INN-hGH-2, or INNhPRL-9, respectively, were diluted in 100 ␮L phosphate-buffered saline (PBS) pH 7.2 and
incubated for two hours at 37°C in a microtiter plate (Nunc, Roskilde, Denmark). Remaining
binding sites were blocked with 200 ␮L of 1% bovine serum albumin (BSA) in PBS for 30
min at 37°C. The plates were then washed three times with PBS containing 0.5 mL Tween
20 and 5 g of thiomersal/liter. For the assay, we used an incubation volume of 100 ␮L/well
and an assay buffer consisting of 50 mM Tris-HC1 (pH 7.75), 9 g/liter NaCl, 5 g BSA/liter,
0.1 g/liter Tween 40, 0.5 g/liter bovine gamma-globulin, and 20 mM Diethylenetriaminepentaacid (Sigma-Aldrich). Graded amounts of the hormone standards or homogenized
tissue/cells (1:2 in assay buffer) were allowed to react on a orbit shaker (500 rpm, 90 min,

280

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

20°C) followed by three washes and subsequent incubation with 100 ng of europium-labeled
detection MCA INN-hPL-5, INN-hGH-5, or INN-hPRL-1, respectively (30 min, 20°C, orbit
shaker). After extensive washing, enhancement solution was added (Pharmacia, Uppsala,
Sweden) and incubated for 5 min on a orbit shaker. Time-resolved fluorescence was
measured for 1 s in a fluorometer (1232 Delfia-fluorometer; Wallac, Turku, Finland).
1.6. Cell proliferation (WST-1 assay)
4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate (WST-1)
is a slightly red tetrazolium salt reduced to the dark-red formazan by the mitochondrial
succinate–tetrazolium–reductase system, which gains substrate reduction by dehyrogenizing
NADH. Proliferation of cells results in an increased mitochondrial reductase system activity,
which leads to increasing amounts of dark-red formazan. The change of color from slightly
red, to dark red assessed by measuring optical density, directly correlates to the number of
viable cells in the sample.
DU 145, PC 3, BPH-1, and prostatic short-term cultured cells, were seeded into 96-well
plates at a density of 5000 cells/well, LnCap at 8000 cells/well in 100 ␮L RPMI 1640
containing 1% FCS, 10 mg/mL penicillin, 100 units/mL streptomycin, and 10 mg/mL
L-glutamin (PSG). Cells were starved for 12 h and then the medium was changed to 100 ␮L
RPMI 1640 containing 1% FCS and hGH (Humatrope௡ 4I.E, Eli Lilly GmbH, Vienna,
Austria), hPL (NIDDK), and hPRL (hPRL-SI AFP-B-2, NIH) dilutions (0.01–10 nM). To
assess cell proliferation, 10 ␮L WST-1 (Boehringer-Mannheim, Germany) was added to
each well after a 48-h growing period. Optical density was measured after a further three
hours at a wavelength of 450 nm in an ELISA reader (Dynatech, Burlington, MA).

2. Results
2.1. GH/PRL-receptor expression in the prostate
PRL-R transcripts were present in the normal prostate and on all seven BPH/PCa samples
(Fig. 2D). Surprisingly, this expression was not observed in the prostatic carcinoma cell lines
PC3, LnCap, or BPH-1 (data not shown); only Du145 cells showed a weak expression of
PRL-R. In contrast, the GH-R transcripts were present in all analyzed BPH/PCa tissue
samples (Fig. 2E) and prostatic cell lines. While PC3, LnCap, and BPH-1 expressed only the
mRNA encoding for the full length GH-R, Du145 cells showed in addition to the classical
transcripts the exon 3 missing mRNA form (Ϫ66 bp).
2.2. Protein hormone expression in the prostate
Even when using the highly sensitive RT-PCR method, 35 cycles of amplification were
not sufficient to detect PRL transcripts in any of the analyzed cell lines (PC3, Du145, LnCap,
and BPH-1), the seven BPH/PCa samples (Fig. 2B), and the normal prostate. In contrast, the
positive control specimens (placenta and PBMCs) showed PRL expression. In a sensitive and

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

281

Fig. 2. Expression of GH/PL, PRL, PRL-receptor, and GH-receptor genes in human prostates. cDNAs were
amplified in 35 cycles and specificities of the amplified products were verified by restriction enzyme digestion of
the cDNA fragments. Five BPH and two PCa samples were analyzed for LDL-R (A), PRL (B), GH/PL (C), GH-R
(D), and PRL-R (E). Human placenta (plac.) known to express PRL, GH/PL, PRL-receptors, and GH-receptors
served as a positive control. GH-R cDNA includes or skips exon 3 (66 bp) (Urbanek et al., 1993). Both Isoforms
of the GH-R bind hGH with identical affinity (Sobrier et al., 1993) and their expression is regulated in an
interindividual rather than a tissue-specific manner (Wickelgren et al., 1995). In addition to the PRL-receptor
mRNA (E), both isoforms of GH-receptor were expressed in all analyzed BPH/PCa specimens (D), but no
transcripts encoding for hPRL (C) and hGH were observed. Only BPH#1 and PCa#6 showed a very weak PL gene
expression (B). Molecular weight marker ϭ 100 bp DNA ladder (Biorad, Hercules, CA).

specific IFMA for hPRL all prostatic tissues and cell lines contained cytosolic hPRL levels
lower than 0.02 ng/mL (Table 2), whereas cytosolic extracts of freshly prepared PBMCs
(5 ϫ 106 cells) contained 1.46 ng PRL/mL (n ϭ 4).
All prostate carcinoma cell lines, as well as the normal prostate and PBMCs, were also
negative in the GH/PL RT-PCR. The GH/PL gene cluster consists of five highly homologous
genes coded as GH-N, GH-V, PL-L, PL-A, and PL-B. In this particular PCR, full length
and/or alternatively spliced transcripts originating from any of these five GH/PL genes can
be amplified. Interestingly, two of seven BPH/PCa samples, one BPH and one PCa, showed

282

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

Table 2
GH/PL/PRL contents in cytosolic extracts of BPH and PCa tissue specimens and cell lines determined by
sensitive IFMAs
Tissue (code)/cell line

hGHa

hPLa

hPRLa

Testis
PBMCs
BPH #4, #5, #8, #10
PCa #7, #9, #11
PC3, Du 145, LnCap, BPH-1

0.51
Ͻ0.005
Ͻ0.005
Ͻ0.005
Ͻ0.005

0.10
Ͻ0.030
Ͻ0.030
Ͻ0.030
Ͻ0.030

5.87
1.46
Ͻ0.020
Ͻ0.020
Ͻ0.020

Tissue: 100 mg/mL
Cells: 5 ϫ 106/mL
Italic: prostatic cancer cell lines.
a
ng/mL.

a very weak expression of the full length mRNAs for GH/PL, comprising all five exons (Fig.
2C). Restriction enzyme analysis of the generated cDNA fragment with GH- (Rsa I) and PL(Xba I) specific nucleases revealed two specific fragments for PL A/B gene transcripts, as did
the positive control placenta (data not shown).
Cytosolic concentrations of hGH and hPL were lower than 0.005 or 0.030 ng/mL in all
analyzed carcinoma cell lines BPH-1, Du 145, PC3, LnCap, in the 7 BPH/PCa samples and
in PBMC (Table 2).
2.3. Effects of GH, PL and PRL on prostate cell proliferation
Effects of exogenous systemic hGH on cell proliferation were studied in vitro in prostatic
cell lines and BPH/PCa tissue specimens expressing the GH-receptor. In addition to the cell
lines Du 145, LnCap, PC3, and BPH-1, prostatic cell cultures of BPH- (BPH#10) or PCa(PCa#12) tissue were also incubated with hGH or hPL ranging from 0.01 to 10 nM in the
presence of 1% FCS. Prostatic cell cultures showed dose-dependent increases in proliferation
(Fig. 3), with greatest responses (138 Ϯ 3.2, BPH#10; 124 Ϯ 2.8, PCa#12; mean Ϯ % SD
referred to the 1% FCS controls) at a doses of 1 nM hGH (Table 3). hPL showed a
proliferative effect (113 Ϯ 6.0) only on the BPH#10 at a concentration of 0.01 nM (Fig. 3),
but not on the PCa#12. Interestingly, the LnCap cell line was sensitive to hGH (130 Ϯ 4.4)
and hPL (133 Ϯ 8.2), whereas the other prostatic cell lines Du 145, PC3, and BPH-1 did not
respond to hGH or hPL.
hPRL increased the proliferation of the BPH#10 (120 Ϯ 4.7) at a concentration of 0.1 nM,
but showed no significant effects in the PCa#12 or in the prostatic carcinoma cell lines
Du145, PC3, LnCap, or BPH-1 (Table 3).

3. Discussion
Involvement of GH and PRL in the physiology of the rodent prostate has recently been
demonstrated (Costello and Franklin, 1994; Reiter et al., 1995), but their roles in the

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

283

Fig. 3. Effects of hGH, hPL, and hPRL on BPH primary culture cell proliferation as determinated by the WST-1
assay. Cells were seeded into 96-well plates at a density of 5,000 to 8,000 cells per well in RPMI 1640 containing
10% FCS. After seven hours, medium was changed to RPMI 1640 containing 1% FCS and the respective
hormone concentration ranging from 0.01 to 10 nM. Proliferation was measured after 48 h. Bars indicate means
of triplicates Ϯ SD. Levels of significance are referred to 1% FCS control group ( * p Ͻ 0.025).

pathology of human BPH or PCa are still debatable. BPH occurs only in humans and dogs;
thus the data obtained in rats and mice may not reflect the appropriate situation in humans,
because only the dorsolateral lobe of rodent prostates is ontogenetically comparable to the
human prostate. It has been shown that systemic administration of GH and PRL can increase
the number of androgen receptors, IGF-I and IGF-I receptors, and 5␣ reductase type I and
II in the prostate of immature hypophysectomized rats (Prins, 1987; Reiter et al., 1992,
1995). Whether these effects are mediated directly or indirectly via systemic IGF-I produced
in the liver remains unclear. Transgenic mice overexpressing rat PRL or bovine GH develop
an enlarged prostate gland, but both transgenes, in addition to elevated IGF-I, also had
increased androgen levels (Wennbo et al., 1997). In these animal models direct and indirect
effects of protein hormones on prostate development and physiology cannot be distinguished. There are only few reports regarding direct effects of protein hormones on human
BPH tissue (Costello and Franklin, 1994; Nevalainen et al., 1997). Immunochemistry and
RT-PCR showed hPRL and the hPRL-R expression in the epithelial cells of human BPH
tissue (Nevalainen et al., 1997). Moreover, hPRL revealed a proliferative effect (conc. 45
nM; 100-fold physiological concentration) on epithelial cell growth in seven-day organ
cultures of BPH tissue.

284

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

Table 3
Effects of hGH, hPL and PRL on proliferation of prostatic primary cell cultures and cancer cell lines
determined by WST-1 assay
Tissue/cell line

hGHa

hPLa

hPRLa

BPH#10
PCa#12
LnCap
Du145, PC3, BPH-1

138 Ϯ 3.2
124 Ϯ 2.8
130 Ϯ 2.4
n.s.

113 Ϯ 6.0
n.s.
133 Ϯ 8.2
n.s.

120 Ϯ 4.7
n.s.
n.s.
n.s.

n.s. ϭ nonsignificant increase of proliferation refereed to 1% FCS control (100 Ϯ 3.4%).
Italic: prostatic cancer cell lines.
a
% mean Ϯ % SD.

Conversely, we did not detect mRNA coding for the 23 K hPRL in any examined
BPH/PCa sample (n ϭ 8) or in human prostatic cell lines (n ϭ 4), although the primer pair
used, located in exon 3 and exon 4/5, amplifies, as expected, placental-, PBMC-, and
pituitary-derived PRL mRNAs. Even with highly sensitive and specific IFMAs (Untergasser
et al., 1997; Madersbacher et al., 1998), we could not detect significant amounts of hPRL
protein in any prostatic cell line or tissue, in contrast to fresh cytosolic extracts of PBMCs
containing significant amounts of hPRL (1.46 ng/mL; Table 2). Moreover, cytosolic extracts
of all prostatic specimens and cell lines were negative for hGH and hPL, indicating that no
auto/paracrine axes, including ectopically produced hPRL or hGH, are involved in the
pathogenesis of BPH or prostate cancer.
Two of seven analyzed BPH/PCa samples showed weak hPL expression at the mRNA
level (Fig. 2C), which is not very surprising, because hPL, normally a trophoblast hormone,
is occasionally produced by extratrophoblastic tumors (Sheth et al., 1977; Campo et al.,
1989; Dirnhofer et al., 1998). Employing different concentrations of hPL (0.01 to 10 nM) in
the WST-1 assay, a significant increase of cell proliferation in BPH#10 and in the androgensensitive prostate cancer cell line LnCap (Table 3) has been observed. Because the receptor
for hPL is still unknown, it is generally believed that this hormone binds to hGH- and/or
hPRL-receptors. hPL binds 2300-fold weaker than hGH to the hGH-receptor (Lowman et al.,
1991; Sobrier et al., 1993; Urbanek et al., 1993). Interestingly, we observed the best
proliferative responses with low concentrations of this somatotrophic hormone (0.01– 0.1
nM), indicating that there is a distinct receptor or signalling pathway for hPL.
hPRL-R receptor mRNA was present in all analyzed BPH/PCa samples (Fig. 2E) and in
the normal prostate, but not in the human prostatic cancer cell lines Du145, PC3, LnCap, and
BPH-1 in our tissue culture approach. Dedifferentiation of the cell lines or genetic instabilities are probably responsible for the loss of the transcripts encoding for full-length receptors.
Only Du145 showed weak expression, but lower than BPH/PCa tissue specimens. Proliferation of the BPH primary culture was significantly increased (Fig. 3, Table 3) at hPRL
concentrations ranging from 0.01 to 0.1 nM. Normal serum values for hPRL in nonpregnant,
nonlactating human adults range between 0.12 nM and 0.6 nM, indicating, that the slightly
increasing physiological PRL values observed in the elderly (Vekemans and Robyn, 1975),
could influence prostatic growth and support BPH development.
Because all BPH/PCa samples express the hGH-receptor gene (Fig. 2D), it is conceivable

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

285

that pituitary-derived endocrine hGH affects differentiation and function of the prostate
gland, as shown in animal models (Reiter et al., 1992, 1995). In this study, we report that in
vitro proliferation of human prostatic cell cultures and the androgen-sensitive human prostatic cell line LnCap can be increased by dose-dependent administration of hGH (Fig. 3).
This endocrine effect is direct, and does not involve testicular sex steroid hormones or
increased hepatic IGF-I. Future studies will include more patients, and should yield further
information on the effects of hGH administration and the in vivo growth of prostatic
carcinoma and BPH. Our findings are relevant in the context of discussed GH substitution
therapies in elderly people, because the age-related decrease of the GH/IGF-I axis might be
a natural mechanism of protection for preventing abnormal growth of prostate and mammary
cells (Siu et al., 1997).
Acknowledgment
This work was supported by the Austrian National Bank (#6120). We also thank the
NIBSB (South Mimms, UK) and NIH (Bethesda, MD) for their generous supply with protein
hormones and Mrs. Regine Gerth for her excellent help in performing the IFMAs.
References
Berry, S. J., Coffey, D. S., Walsh, P.C., & Ewing, L. L. (1984). The development of human benign prostatic
hyperplasia with age. J Urol 132, 474 – 479.
Boutin, J. M., Edery, M., Shirota, M., Jolicoeur, C., Lesueur, L., Ali, S., & Kelly, P. A. (1989). Identification of
a cDNA encoding a long form of prolactin receptor in human hepatoma and breast cancer cells. Mol
Endocrinol 3, 1455–1461.
Boyum, A. (1968). Isolation of mononuclear cells and granulocytes from human blood. Scand J Clin Lab Invest
21, 77– 82.
Byrne, R. L., Leung, H., & Neal, D. E. (1996). Peptide growth factors in the prostate as mediators of stromal
epithelial interaction. Br J Urol 77, 627– 633.
Calao, A., Marzullo, P., Ferone, D., Spieza, S., Cerbone, G., & Lombardi, G. (1998). Prostatic hyperplasia: an
unknown feature of acromegaly. J Clin Endocrinol Metab 83, 775–779.
Campo, E., Algaba, F., Palacin, A., Germa, R., Sole-Balcells, F. J., & Cardesa, A. (1989). Placental proteins in
high-grade urothelial neoplasms. An immunohistochemical study of human chorionic gonadotropin, human
placental lactogen and pregnancy-specific beta-1-glycoprotein. Cancer 63, 2497–2504.
Chen, E. Y., Liao, Y. C., Smith, D. H., Barrena-Saldana, H. A., Gelinas, R. E., & Seeburg, P. H. (1989). The
growth hormone locus: nucleotide sequence, biology and evolution. Genomics 4, 479 – 497.
Chomcynski, P., & Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate–
phenol– chloroform extraction. Anal Biochem 162, 156 –159.
Cooke, N. E., Coit, D., Shine, J., Baxter, J. D., & Martial, J. A. (1981). Human prolactin cDNA structural analysis
and evolutionary comparisons. J Biol Chem 256, 4007– 4016.
Costello, L. C., & Franklin, R. B. (1994). Effect of prolactin on the prostate. Prostate 24, 162–166.
Culig, Z., Hobisch, A., Cronauer, M. V., Radmayr, C., Hittmair, A., Zhang, J., Thurnher, M., Bartsch, G., &
Klocker, H. (1996). Regulation of prostatic growth and function by peptide growth factors. Prostate 28,
392– 405.
Dirnhofer, S., Berger, C., Hermann, M., Steiner, G., Madersbacher, S., & Berger, P. (1998). Coexpression of
gonadotropic hormones and their corresponding FSH- and LH/CG-receptors in the human prostate. Prostate
35, 212–220.

286

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

Dirnhofer, S., Koessler, P., Ensinger, C., Feichtinger, H., Madersbacher, S., & Berger, P. (1998). Production of
trophoblastic hormones by association to tumor stage and grade. Hum Pathol 29, 377–382.
Glyn, R. J., Campio, E. W., Bouchard, G. H., & Silbert, J. E. (1985). The development of human benign prostatic
hyperplasia among volunteers in the Normative Aging study. Am J Epidemiol 121, 78 –90.
Griffiths, K. (1996). Molecular control of prostate growth. In R. Kirby (Ed.), Textbook of benign prostatic
hyperplasia (pp. 35–55). Oxford: ISIS Medical Media.
Juul, A., Main, K., Blum, W. F., Lindholm, J., Ranke, M. B., & Skakkebaek, N. E. (1994). The ratio between
serum levels of insulin-like growth factor (IGF)-1 and the IGF binding proteins (IGFBP-1, 2 and 3) decrease
with age in healthy adults and is increased in acromegalic patients. Clin Endocrinol Oxf 41, 85–91.
Krieg, M., Nass, R., & Tunn, S. (1993). Effects of aging on endogenous level of 5␣-dihydrotestosterone,
testosterone, estradiol and estrogen in epithelium and stroma of normal and hyperblastic human prostate.
J Clin Endocrinol Metab 77, 375–381.
Leung, D., Spencer, S. A., Cachianes, G., Hammods, R. G., Collins, C., Henzel, J., Barnard, R., Waters, M. J.,
& Wood, W. I. (1987). Growth hormone receptor and serum binding protein: purification, cloning and
expression. Nature 330, 537–543.
Lowman, H. B., Cunningham, B. C., & Wells, J. A. (1991). Mutational analysis and protein engineering of
receptor-binding determinants in human placental lactogen. J Biol Chem 266, 10982–10988.
Madersbacher, S., Stulnig, T., Schonitzer, D., Huber, L. A., Wick, G., Dirnhofer, S., & Berger, P. (1993). Serum
¨
glycoprotein hormones and their free alpha-subunit in a healthy elderly population selected according to the
SENIEUR protocol. Analyses with ultra sensitive time resolved fluoroimmunoassays. Mech Ageing Dev 71,
223–233.
Madersbacher, S., Untergasser, G., Gerth, R., Hermann, M., Schwarzler, P., Dirnhofer, S., & Berger, P. (1998).
¨
Reassessment of the role of human placental lactogen in physiological non-pregnant and pathological
conditions. Exp Clin Endocrinol Diabetes 106, 61– 67.
Neaves, W. B., Johnson, L., Porter, J. C., Parker, C. R., Petty, C. S. Leydig cell numbers, daily sperm production
and serum gonadotropin levels in aging men. J Clin Endocrinol Metab 55, 756 –763.
Nevalainen, M., Valve, E., Ingleton, P., Nurmi, M., Martikainen, P., Harkonen, P., (1997). Prolactin and prolactin
¨ ¨
receptors are expressed and functioning in the human prostate. J Clin Invest 99, 618 – 627.
Prins, G. S. (1987). Prolactin influence on cytosol and nuclear androgen receptors in the ventral, dorsal and lateral
lobes of the prostate. Endocrinology 120, 1457–1464.
Rajah, R., Valentinis, B., & Cohen, P. (1997). Insulin-like growth factor (IGF)-binding protein-3 induces
apoptosis and mediates the effects of transforming growth factor-beta 1 on programmed cell death through a
p53- and IGF-independent mechanism. J Biol Chem 272, 12181–12188.
Reiter, E., Bonnet, P., Sente, B., Dombrowicz, D., Closset, J., & Hennen, G. (1992). Growth hormone and
prolactin stimulate androgen receptor, insulin-like growth factor-I (IGF-I) and IGF-I receptor levels in the
prostate of immature rats. Mol Cell Endocrinol 88, 77– 87.
Reiter, E., Kecha, Q., Hennuy, B., Lardinois, S., Klug, M., Bruyninx, M., Closset, J., & Hennen, G. (1995).
Growth hormone directly affects the function of the different lobes of the rat prostate. Endocrinology 136,
3338 –3345.
Shapiro, E., & Steiner, M. S. (1996). Role of growth factors in prostatic development. In R. Kirby (Ed.), Textbook
of benign prostatic hyperplasia (pp. 17–19) Oxford: ISIS Medical Media.
Sheth, N. A., Suraiya, J. N., Sheth, A. R., Ranadive, K. J., & Jussawalla, D. J. (1977). Ectopic production of
human placental lactogen by human breast tumors. Cancer 39, 1693–1697.
Siu, T., Zhou, J., Adesanya, O., Wang, J., Leroith, D., & Bondy, C. (1997). Growth hormone treatment induces
mammary gland hyperplasia in aging primates. Nature Medicine 3, 1141–1144.
Sobrier, M. L., Duquesnoy, P., Duriez, B., Amselem, S., & Goossens, M. (1993). Expression and binding
properties of two isoforms of the human growth hormone receptor. FEBS Lett 319, 16 –20.
Untergasser, G., Kranewitter, W., Dirnhofer, S., Madersbacher, S., & Berger, P. (1997). Organ-specific expression pattern of the growth hormone/placental lactogen gene-cluster in the testis. Mol Cell Endocrinol 130,
53– 60.

G. Untergasser et al./Experimental Gerontology 34 (1999) 275–287

287

Urbanek, M., Russell, J. E., Cooke, N. E., & Liebhaber, S. A. (1993). Functional characterization of the
alternatively spliced placental human growth hormone receptor. J Biol Chem 268, 19025–19032.
Vekemans, M., & Robyn, C. (1975). Influence of age on serum prolactin levels in women and men. Br J Med
4, 738 –739.
Veldhuis, J. D., & Leim, A. Y. (1995). Differential impact of age, sex steroid hormones and obesity on basal vs.
pulsatile growth hormone secretion in men assessed in an ultra sensitive chemiluminescence assay. J Clin
Endocrinol Metab 80, 3209 –3222.
Vermeulen, A. (1991). Androgens in the aging male. J Clin Endocrinol Metab 73, 221–224.
Wennbo, H., Kindblom, J., Isaksson, O., & Tornell, J. (1997). Transgenic mice overexpressing the prolactin gene
¨
develop dramatic enlargement of the prostate gland. Endocrinology 138, 4410 – 4415.
Wickelgren, R., Landin, K., Ohlsson, C., & Carlsson, L. (1995). Expression of exon 3-retaining and exon
3-excluding isoforms of the human growth hormone-receptor is regulated in an interindividual, rather than a
tissue-specific, manner. J Clin Endocrinol Metab 80, 2154 –2157.