Mechanisms of Ageing and Development
100 (1998) 25 – 40

Age-related decrease in the responsiveness of rat
articular chondrocytes to EGF is associated with
diminished number and affinity for the ligand of
cell surface binding sites
Didier Ribault, Messai Habib, Khatib Abdel-Majid, Alain Barbara,
Dragoslav Mitrovic *
INSERM U-349, 6 rue Guy Patin, 70510 Paris, France
Received 22 November 1996; received in revised form 15 July 1997; accepted 23 July 1997

Abstract
The effect of age on the responsiveness of articular chondrocytes (AC) to epidermal
growth factor (EGF) was examined. Cells were isolated by digesting cartilage fragments from
the humeral and femoral heads of 21-day old, 8- and 14-month old rats with collagenase.
The cells were cultured under standard conditions, as monolayers. DNA synthesis was
measured by [3H]thymidine incorporation and cell proliferation by the DNA content of
subconfluent cultures. [125I]EGF binding and the amounts of EGF and EGF-receptor
mRNAs were determined using confluent cells. DNA synthesis was decreased with age of
animals. EGF stimulated DNA synthesis in cultures in 1- and 8-month old rats at low serum
concentrations ( B5%), and in cultures in 14-month old animals at high serum concentrations. It also increased 5-day DNA content of cultures compared to serum-treated controls
but this effect was weak in cultures in 14-month old rats. The number of high affinity
binding sites for [125I]EGF decreased from 37 800 in the 1-month old to 1950 in the 14-month
old rat AC. The apparent dissociation constant (Kd) also decreased with age: 0.18 nmol/l in
the 1-month old; 0.12 nmol/l in the 8-month old; and 0.07 nmol/l in the 14-month old cells.
AC in older rats contained more EGF mRNA and less EGF-receptor mRNA. Incubation of
the cells with EGF resulted in down regulation of the EGF- and upregulation of EGF-receptor mRNA expressions. These findings show the age-related quantitative and qualitative
* Corresponding author. Tel.: +33 1 49956447; fax: + 33 1 49958452.
0047-6374/98/$19.00 © 1998 Elsevier Science Ireland Ltd. All rights reserved.
PII S 0 0 4 7 - 6 3 7 4 ( 9 7 ) 0 0 1 1 5 - 2

26

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

alterations in EGF and EGF-receptor which may account, at least in part, for the diminished
responsiveness of senescent AC to EGF. © 1998 Elsevier Science Ireland Ltd.
Keywords: Aging; Epidermal growth factor; Rat articular chondrocytes; DNA synthesis;
EGF-receptor; EGF- and EGF-receptor mRNAs expressions

1. Introduction
Cellular senescence in culture is associated with a gradual decline in mitotic
activity, in which the number of population doublings is inversely proportional to
the age of a donor (Hayflick and Moorhead, 1961; Hayflick, 1965; Martin et al.,
1970; Schneider and Mitsui, 1976; Golstein et al., 1978). This is usually interpreted
as an expression of cellular aging (Norwood et al., 1990). The decline in the
replicative capacity of senescent cells is usually attributed to the gradual increase in
the fraction of cells arrested in the nonreplicative phase, near the G1/S boundary of
the cell cycle, just before the onset of DNA synthesis (Rittling et al., 1986;
Cristofallo, 1988; Afshari et al., 1993). The failure of senescent cells to initiate DNA
synthesis and replicate is associated with a diminished responsiveness to mitogenic
stimuli such as growth factors including the epidermal growth factor (EGF)
(Phillips et al., 1984; Ishigami et al., 1993; Tang et al., 1994; Li et al., 1995).
There is good experimental evidence indicating that cellular senescence is controlled by an active dominant genetic programme (Rittling et al., 1986; Hensler and
Pereira-Smith, 1995; Goldstein, 1990; Ning and Pereira-Smith, 1991; Goletz et al.,
1993; Doggett et al., 1992; Pang and Chen, 1994) and that senescent cells no longer
initiate the transcription of certain growth regulatory genes such as c-fos protooncogene (Seshadri and Campisi, 1990). Although, changes underlying the cellular
senescence are still poorly understood, a good deal of evidence points to differences
in gene expression in young and senescent cells (Rittling et al., 1986; Li et al., 1995;
Doggett et al., 1992; Dereventzi et al., 1996; Tahara et al., 1995).
EGF is a potent mitogen for many cells including chondrocytes (Vivien et al.,
1990; Kinoshita et al., 1992; Ribault et al., 1997). This 53 amino acid polypeptide
with a molecular weight of 6045 Da exerts its biological effects, only after it is
bound to specific cell surface receptors. Once it is bound to its receptor, it activates
the receptor’s intracellular tyrosine kinase domain resulting in a phosphorylation of
tyrosine residues and in the generation of a signal which initiates DNA synthesis,
cell cycle progression, and cellular proliferation (Carpenter and Wahl, 1990). EGF
extends the replicative life span and increases the saturation density of human
diploid fibroblasts in vitro (Carpenter and Cohen, 1976; Kaji and Matsuo, 1983),
but these effects decrease with cellular ageing in vitro. The unresponsiveness of
senescent cells to EGF does not seem to be associated with quantitative or
qualitative changes in the EGF-receptors (Phillips et al., 1984; Ishigami et al., 1993)
or to EGF-induced activation of the receptor’s tyrosine kinase domain (Gerhard et
al., 1991). However, Tang et al. (1994) recently reported a decrease in EGF receptor
mRNA expression in fibroblasts that had attained their maximal life span.

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

27

EGF has occasionally been reported to have a mitogenic action in chondrocytes
(Vivien et al., 1990; Kinoshita et al., 1992; Ribault et al., 1997), and these cells bear
specific high and low affinity receptors (Kinoshita et al., 1992; Ribault et al., 1997).
Although, to our knowledge, the effect of EGF on chondrocytes derived from
young, mature and old donors has not been studied. We have therefore examined
the effects to EGF on articular chondrocytes (AC), isolated from young, mature
and old rats and measured its mitogenic action, the presence of specific binding
sites, and the expression of EGF- and EGF receptor-specific mRNA.

2. Materials and methods

2.1. Cell culture
Rat ACs were isolated from the humeral and femoral heads of 21-day old, 8- and
14-month old male Wistar rats (Charles River, France) (Ribault et al., 1997).
Briefly, cartilage slices were digested at 37°C for 10 min (young) or 5 min (old) with
0.05% trypsin-3 mM EDTA solution (Eurobio, France) with gentle shaking to
remove contaminant cells and cell debris. The chondrocytes were then released by
incubation for 1 – 2 h (1-month old rats) and 10 min (older animals) with 0.1%
bacterial collagenase (Type IA, Sigma, St. Louis, MO). The released cells were
sedimented and washed by centrifugation (5 min at 450× g) with DMEM nutrient
medium. The cells were seeded in 25 cm2 sterile plastic flasks at 2 × 106 cells and
cultured under standard conditions (37°C, 95% humidified atmosphere, 5% CO2) in
DMEM nutrient medium containing serum and antibiotics (100 IU/ml penicillin
and 50 mg/ml streptomycin). The cells in young rats were cultured in the medium
containing 10% fetal calf serum (FCS), and cells in old animals in serum containing
10% FCS and 10% horse serum.
The confluent cells, 4 – 5 days after seeding, were detached by gentle shaking for
5–10 min with trypsin-EDTA solution. The isolated cells were collected and
washed by centrifugation, and the suspended cells seeded in 24-well Falcon culture
plates at 2× 104 cells per well, or in culture flasks at 1× 104 cells per cm2. First
passage cells were used in all experiments. The culture medium was changed every
3–4 days.

2.2. DNA synthesis and cell proliferation
DNA synthesis was monitored by measuring the incorporation of [3H]thymidine
into nuclear DNA, and cell proliferation by measuring the DNA content (West et
al., 1985) of the cultures. The cells were seeded and cultured under standard
conditions in 24-well plates; the medium was replaced with DMEM containing
0.2% FCS on the 3rd day after seeding. This medium was removed the next day and
cells were incubated for 24 h in medium containing 2.5% FCS and (except controls)
indicated concentrations of human recombinant EGF (Genzyme). [3H]thymidine (1
vCi/ml, NEN) was added for the last 6 h of incubation.

28

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

The labelled cell monolayers were washed with PBS, fixed in cold 5% TCA
(2× 15 min), then in cold 80% ethanol and lysed at 37°C for 2 h in 400 vl 10 mM
EDTA, pH 12.3. The alkaline lysates were neutralized with 20 vl 1 M KH2PO4 and
200 vl samples, were counted in a liquid scintillation counter (LKB Wallac 1409).
The neutralized alkaline digests were also used to measure the DNA content of the
cultures. The results are expressed as the means of at least four cultures 9 1 S.D.
and were compared with controls using Student’s ‘t’ test.

2.3. [ 125]EGF binding
Binding studies were performed using 90% confluent AC cultured in 24-well
plates (Ribault et al., 1997). In order to block the non-specific binding sites,
serum-starved cell monolayers were pre-incubated for 1 h at 37°C degree in PBS
plus 0.2% bovine serum albumin (BSA) and then 60 000 cpm of the human
recombinant [125I]EGF (900 Ci/mmol, Amersham) were added per ml of the
binding buffer. Preliminary experiments showed that [125I]EGF binding reached a
plateau in less than 2 h at room temperature. Cells were then washed three times
with the binding buffer, lysed with 1 ml 1 N NaOH, and the lysates counted in an
LKB k-counter.
Saturation curves were obtained at room temperature by incubating cell monolayers for 2 h in the binding buffer containing increasing concentrations of
[125I]EGF. Displacing curves were obtained similarly in the presence of [125I]EGF
(60 000 cpm/ml of binding buffer) and increasing concentrations of unlabelled
EGF. Non-specific binding was determined by subtracting the [125I]EGF binding
obtained in the presence of 200-fold excess of unlabelled EGF from the corresponding total binding data.

2.4. RNA isolation
Total cellular RNA was isolated from 90% confluent rat AC monolayers subcultured in 75 cm2 flasks. The serum-starved cells were incubated for 24 h without or
with 2.5 ng/ml EGF in the presence of 2.5% FCS as described above for DNA
synthesis prior to RNA extraction. The cell monolayers were then rinsed with PBS
and total RNA isolated using the Rapid RNA™ purification kit (Amresco, USA).
RNA pellets were collected by centrifugation (10 min, 4°C, 15 000× g), air dried,
and resuspended in 100 vl sterile diethylpyrocarbonate-treated water. The concentration and purity of the total cellular RNA were determined by spectrophotometry
at 260, 280 and 230 nm.

2.5. Oligonucleotide primer design and RT-PCR
The oligonucleotide primers used for RT-PCR were designed from published
cDNA sequences (Saggi et al., 1992; Avivi et al., 1991; Tso et al., 1985) and were
synthesized by Genosis Biotechnologies (England). The sense and antisense primers
in the 5%, 3% direction were: for EGF, sense position 3033–3056 (GCTCAGACT-

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

29

GTCCTCCCACCTCG), antisense position 3482–3460 (CCCGTAGTCAGCATGGCGCAGC) (Saggi et al., 1992); for EGF-receptor sense position 1260–1282
(GGACCTTCACATCCTGCCAGTG), antisense position 1870–1848 (GGTGATGTTCATGGCCTGGGGC) (Avivi et al., 1991); for glyceraldehyde-3-phosphate
dehydrogenase (GAPDH), sense position 260–280 (TGCTGGTGCTGAGTATGTCG), anti-sense position 907 –888 (ATTGAGAGCAATGCCAGCC) (Tso et al.,
1985). These gave PCR products of 449 base pairs for EGF, 610 base pairs for
EGF-receptor and 646 base pairs for GAPDH. Reverse transcription and PCR
amplification were performed as described elsewhere (Ribault et al., 1997) with
modifications. In the preliminary experiments, it was established that linear concentration-related RT-PCR amplifications were achieved with 2.5 vg RNA and 30
cycles for EGF, with 1.5 vg RNA and 25 cycles for EGF-receptor. GAPDH was
amplified under the same conditions as each of the above genes. Genomic contamination was checked by monitoring amplification in the absence of MMLV-reverse
transcriptase after digestion of 4 vg RNA by RNAase A (10 mg/ml) for 1 h at
37°C.

2.6. Analysis of RT-PCR products
The PCR products were analyzed by agarose (2%) gel electrophoresis in Tris–borate – EDTA buffer (89.2 mM Tris, 89 mM boric acid, 0.05 mM EDTA pH 8.3)
containing 0.1 vg/ml ethidium bromide, for 1 h at 20°C at 10 V/cm. The DNA
bands, stained with ethidium bromide, were visualized and photographed under UV
light using positive/negative instant film (Polaroid Kodak). DNA molecular weight
markers (marker VI from Boehringer) were used to determine the sizes of the
amplified products.
All PCR products were transferred to nylon sheets and hybridized with synthetic
oligonucleotide probes labelled with k 32P-ATP (10 mCi/ml, NEN) by T4 polynucleotide kinase (ATGC, USA). These probes were designed from published sequences
and recognized a unique sequence located between the PCR primer templates. The
sequences of oligonucleotides were: for EGF (5%GCCCATCAGCACCTGGACTGCC3%), spanning nucleotides 3227 and 3249; for EGF-receptor (5%GTGAGCAGAGGCAGGGAGTGCG3%), spanning nucleotides 1744 and1766; and for
GAPDH (5%CATGGACTGTGGTCATGAGC3%), spanning nucleotides 512 and
532. The hybrids were revealed by autoradiography using Hyper film MP (Amersham). The films and membranes were exposed for 1–2 h at −80°C and then
processed routinely. The radioactive bands wee analyzed by scanning densitometry.

3. Experimental results
At serum concentration of 2.5%, EGF induced a concentration-dependent increase in [3H]thymidine incorporation by AC in all three age groups of rats (Fig. 1).
The AC in 1-month old animals responded much better than cells in 8-month old

30

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

and 8-month old animals responded much better than cells in 14-month old
animals. The effect was highly significant at 0.25 ng/ml of EGF. In all cultures
maximal stimulation was attained with 1 ng/ml, but the effect decreased significantly at 10 ng/ml in cultures in 1- and 8-month old rats. The response of AC in
young and old rats also differed with respect to FCS concentration (Fig. 2). AC in
1-month old rats responded to EGF maximally at low serum concentration
(B 2.5%). The effect decreased gradually at higher serum concentration (] 5%) and
completely disappeared at 10% FCS (Fig. 2a). The cells in 8-month old animals
responded better at low serum concentration and were relatively insensitive at high
serum concentration (Fig. 2b). In contrast, AC in 14-month old rats were poorly
stimulated by EGF at low serum concentration and responded much better to the
factor at higher (] 2.5%) serum concentration (Fig. 2c). The effects of FCS or FCS
plus 2.5 ng/ml EGF on cell proliferation are shown in Fig. 3. The DNA content of
all cultures increased as a function of serum concentration, but much more in
cultures in 1-month old animals. The exposure of cells for 5 days to 2.5 ng/ml EGF,
resulted in an increase of the DNA content which was consistently higher than in
cultures lacking EGF. FCS (1%) increased the DNA content of cultures in 1-month
old rats by a factor of 1.83, whereas similar increase was achieved at 5% FCS in a
8-month old cultures. In the range of serum concentrations tested, DNA content of
cultures in 14-month old rats was much less affected by EGF. Growth-arrested AC
incubated with FCS or FCS and EGF, did not incorporate [3H]thymidine during
the 12 – 15 h after the stimulus had been given (Fig. 4). Only a small fraction of cells
initiated DNA synthesis at 15 h and a somewhat larger fraction after 18 h of
stimulation. Again, a significantly larger proportion of AC in 1-month old rats

Fig. 1. The effect of EGF on [3H]thymidine incorporation. The serum-starved subconfluent cell
monolayers in Falcon 24-well plates were exposed for 24 h to indicated concentrations of EGF in the
presence of 2.5% FCS. The cells were labeled with [3H]thymidine for the last 6 h of culture and the
radioactivity and DNA content determined as described in Section 2. The vertical columns are the means
of four cultures and vertical bars indicate one standard deviation. All results are highly significant
(Student ‘t’ test) comparing experimental and the corresponding control (no EGF) culture.

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

31

Fig. 2. The effect of FCS, or FCS plus EGF on [3H]thymidine incorporation. The experimental
conditions were as in the legend of Fig. 1. The [3H]thymidine incorporation and DNA content were
determined 24 h after the cells have been exposed to the indicated concentrations of FCS or FCS plus
2.5 ng/ml EGF. Vertical columns are the means of four cultures and vertical bars indicate one standard
deviation. The figures within columns are the ratios of the means: EGF-treated over the corresponding
EGF-untreated cultures.

32

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

Fig. 3. The effect of FCS or FCS plus EGF on cell proliferation. The experimetal conditions were as in
the legend of Fig. 1. The DNA content was measured 5 days after exposure of cells to the indicated
concentrations of FCS or FCS plus 2.5 ng/ml EGF. Vertical columns are the means of six cultures and
vertical bars indicate one standard deviation. The figures within columns are ratios of the means:
EGF-treated over the corresponding EGF-untreated cultures.

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

33

Fig. 4. The time-course of the effect of EGF on [3H]thymidine incorporation. The experimental
conditions were as in the legend of Fig. 1. The serum-starved cells were incubated for the indicated
periods with 2.5% FCS, or FCS plus 2.5 ng/ml EGF and labelled with [3H]thymidine for the last 2 h in
culture. The results are the means of four cultures. Standard deviations are not indicated for the sake of
clarity, but the differencies found for EGF-treated and EGF-untreated cultures are significant (Student
‘t’ test) at 15 h and later times of incubation.

incorporated [3H]thymidine at and after 15 h of stimulation compared to the cells
derived from old rats.
The time course of [125I]EGF binding at 20°C to cell monolayers is shown in Fig.
5. There was much less [125I]EGF binding per vg DNA by AC in 14-month old

Fig. 5. Time course of [125I]EGF binding at room temperature. 90% confluent monolayers were
incubated for 24 h in medium containing 0.2% FCS, then for 1 h at 37°C with PBS containin 0.2% BSA.
The binding was performed at room temperature in the above binding buffer containing [125I]hrEGF
(60 000 cpm in 1 ml) for the indicated times. After careful rinsing, the cells were lysed and the total
bound radioactivity was determined with an LKB gamma counter. The results are means of 4 cultures.
The standard deviations are not indicated for the sake of clarity.

34

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

rats, although binding (plateau) was saturated earlier (45 min) than for the younger
cells (120 min). An incubation time of 2 h was therefore used in subsequent binding
experiments.
Total, specific and non-specific bindings and the corresponding Scatchard plots
are shown in Fig. 6. The specific binding was more than 80% of the total binding
in all three types of culture and Scatchard plot analysis of the binding data
indicated the presence of a single class of high affinity binding sites, only. Table 1
summarizes the binding data as obtained by computer analysis. As it is apparent,
the binding affinity (Kd) decreased with age of cells from 0.18 nM for the 1-month
old to 0.07 nM for the 14-month old cells. The maximal binding (Bmax) also
decreased from 5.04× 10 − 11 – 2.61× 10 − 12 mol/vg DNA for the AC in old rats.
There were 37 800, 8900 and 1950 binding sites per cell for cultures derived from 1-,
8- and 14-month old rats, respectively.
The mRNAs for EGF and the EGF-receptor in unstimulated and EGF-stimulated rat AC were revealed by RT-PCR of the total extracted RNA. The amplified
cDNA products were separated by agarose gel electrophoresis and stained with
ethidium bromide. The products migrated in the gel at the positions predicted from
the respective cDNA sequences 449 bp for EGF, and 610 bp for the EGF-receptor.
The PCR products were transferred to nylon membranes and hybridized with
k 32P-labelled specific oligonucleotides. cDNA fragments of 449 and 610 bp interacted with the respective probes (Fig. 7). It is apparent that AC in 8- (lanes 3 and
4) and 14- (lanes 5 and 6) month old rats contain more EGF mRNA and less
EGF-receptor mRNA (lanes 1, 3 and 5). EGF stimulation also decreased the
amount of mRNA transcripts specific for EGF, and increased that of EGF-receptor
mRNA in all three types of cells (lanes 2, 4 and 6). Fig. 8 shows densitometric
semi-quantitative analysis of the scans of the Fig. 7.

4. Discussion and conclusions
These results show several age-related alterations in chondrocytes derived from
the articular cartilage of adult rats. The cells from mature and aged rats have a
decreased proliferative capacity and responsiveness to EGF. The concentration of
EGF needed to stimulate DNA synthesis was about the same for young and old
cells, but considerably less DNA was synthesized by old cells. EGF initiated DNA
synthesis more effectively in young cells at a low serum concentration, but worked
best at a higher serum concentration in old cells. EGF increased the DNA content
of cultures at all the serum concentrations studied. The induction of DNA synthesis
following growth arrest starts approximately 18 h after the cells have been
challenged with FCS or FCS plus EGF. EGF does not shorten this time lag but it
does increase the number of cells that initiate DNA synthesis. Assuming that each
dividing cell incorporates the same amount of [3H]thymidine, the fraction of cells
that enter the S phase of the cell cycle is always much greater in cultures from
young animals and in those exposed to EGF.

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

35

Fig. 6. Receptor saturation curve and Scatchard analysis. Cells were incubated for 2 h with increasing
concentrations of [125I]EGF as described in the legend of Fig. 5. The cells were carefully rinsed, and the
total bound radioactivity was determined. Specific binding was determined by subtracting the binding
measured in the presence of a 200-fold excess of unlabelled EGF from the total binding values. Inset
shows the Scatchard plots of the binding data for AC in 1- and 14-month old rats.

36

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

Table 1
(125I)EGF-receptor binding data*
1-month old
Kd (nM)
Bmax (M/vg DNA)
No. of receptors

8-month old

14-month old

0.18
5.04×10−11
37 800

0.12
9.21×10−12
16 750

0.07
2.61×10−12
1950

* The data are obtained by computer analysis of the results shown in Fig. 6.

It has been reported that the responsiveness of cells to growth factors, including
EGF, and the number of cell divisions in vitro diminish with the age of the cell
donor (Gospodarowicz and Meschern, 1977; Dominice et al., 1986; Chen et al.,
1990; Colige et al., 1990; Matsuda et al., 1992; Ishigami et al., 1993; Tang et al.,
1994; Li et al., 1995). The diminished proliferative capacity of senescent cells is
associated with a gradual loss of cell responsiveness to growth factors like EGF.
This could be ascribed to quantitative and/or qualitative changes in specific
receptors, but the published findings on this point are not unanimous. Some studies
found no significant age-related changes in the density or binding affinity of
EGF-specific receptor (Phillips et al., 1983; Ishigami et al., 1993). However, other
studies have reported fewer EGF-receptors in cells from older donors (Carlin et al.,
1983; Matsuda et al., 1992; Marti, 1993).

Fig. 7. Autoradiographs of RT-PCR products amplified with oligonucleotide primers for EGF,
EGF-receptor and GAPDH. Amplified PCR products were separated and analyzed as described in
Section 2. They were hybridized with the corresponding oligonucleotide probe labelled with k 32P-ATP.
The hybrids were revealed by autoradiography and films were scanned. 1 and 2: 1-month old; 3 and 4:
8-month old; 5 and 6: 14-month old rats. Upper row shows hybrids of gene-specific cDNA coding for
EGF-proteins; third row shows hybrids of gene specific cDNA coding for EGF-receptor protein. Lanes
1, 3 and 5: the cells were not stimulated with EGF prior to extraction of RNA. Lanes 2, 4 and 6: the
cells were stimulated for 24 h with 2.5 ng/ml EGF prior to extraction of RNA. GAPDH was used as an
internal standard for amplification protocol.

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

37

Fig. 8. Graphic representation of the scans in Fig. 7. Columns represent the relative density of the bands
expresed as per cent of the corresponding GAPDH band density. (A) Scans of the EGF, upper row in
Fig. 7. (B) Scans of the EGF-receptor, third row in Fig. 7.

Our results also indicate that a decrease in the number and binding affinity of
EGF receptors can account for the lower responsiveness of senescent rat AC to
EGF. The number of EGF receptors and their binding affinity were dramatically
decreased in cells isolated from old rats. The number of binding sites dropped from
37 800 in cells in 1-month old to 1950 in those in 14-month old rats. The Kd value
decreased similarly from 0.18 to 0.07 nmol/l.
The reasons for these discrepancies are not known, but differences in the methods
used may be important. It is intriguing that no evidence for receptor alteration have
been reported in studies of cell senescence in vitro (Ishigami et al., 1993; Gerhard
et al., 1991; Carlin et al., 1983), whereas alteration are seen in cells derived from
donors of different ages (Matsuda et al., 1992; Marti, 1993). However, the lower
responsiveness of senescent AC to growth factors may also be associated with an
increased number and unchanged affinity for the ligand of the specific binding sites
as we have obtained for insulin like growth factor 1 (not shown).
In agreement with the binding study results, there were also age-related differences in the EGF and EGF-receptor mRNA expressions. Decreased EGF-receptor
mRNA expression in cells from older animals supports the binding data. Surprisingly, we also found that the amount of EGF mRNA is increased in old cells and
that EGF modulates the expression of both EGF and EGF-receptor mRNAs. The
modulation of the expression of the EGF-receptor mRNA by EGF is observed in
several studies, independently of age (Clark et al., 1985). The significance of these
findings is unclear. The feed-back mechanism could be put forward to explain an

38

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

over expression of EGF mRNA in senescent cells where the number of receptors
also decreases. Many different mechanisms could alter the amounts of receptor in
senescent cells. For instance, mRNA stability, translational efficiency, rates of
synthesis, post-translational modifications and the turnover of the EGF-receptor.
Several other abnormalities are associated with cellular aging, in addition to the
changes in the receptor density and affinity. There is transcriptional repression of
several growth regulatory genes such as c-fos in senescent human fibroblasts
(Seshadri and Campisi, 1990), gas-1 and gas-6 in senescent murine fibroblasts
(Cowled et al., 1994), a post-transcriptional block of proliferative cell nuclear
antigen (PCNA) (Chang et al., 1991) and a translational defect in ornithine
decarboxylase (Seshadri and Campisi, 1990). Other genes, which products inhibit
cell proliferation, are in contrast expressed or over expressed in senescent cells.
These include p 21(sdi 1/cip 1/waf 1) which blocks kinase activity of Cdks (Tahara
et al., 1995) and interacts with PCNA (Waga et al., 1994), prohibit, interleukin-1h
(a potent inhibitor of cell proliferation), bcl-2 which is associated with apoptosis
(Dereventzi et al., 1996) and others.
Future investigations, on the aging of AC will concentrate on the age-related
changes in gene expression that may be induced by EGF in vitro.

References
Afshari, C.A., Vojta, P.J., Annab, L.A., Frutreal, P.A., Willard, T.B., Barrett, J.C., 1993. Investigation
of the role of G1/S cell cycle mediators in cellular senescence. Exp. Cell Res. 209, 231 – 237.
Avivi, A., Lax, I., Ulrich, A., Schlessinger, J., Givol, D., Morse, B., 1991. Comparison of EGF receptor
sequences as a guide to study the ligand binding site. Oncogene 6, 673 – 676.
Carlin, C.R., Phillips, P., Knowles, B., Cristofalo, V.J., 1983. Diminished in vitro tyrosine kinase activity
of the EGF receptor of senescent human fibroblasts. Nature 306, 617 – 620.
Carpenter, G., Cohen, S., 1976. Human epidermal growth factor and the proliferation of human
fibroblasts. J. Cell. Physiol. 88, 227–237.
Carpenter, G., Wahl, M.I., 1990. The epidermal growth family. In: Sporn, M.B., Roberts, A.B. (Eds.),
Peptide Growth Factor and Their Receptors. Springer-Verlag, New York, pp. 69 – 171.
Chang, C.D., Phillips, P., Lipson, K.E., Cristofalo, V.J., Baserga, R., 1991. Senescent human fibroblasts
have a post-transcriptional block in the expression of the proliferating cell nuclear antigen gene. J.
Biol. Chem. 256, 8663–8666.
Chen, J.J., Brot, N., Weissbach, H., 1990. RNA and protein synthesis in cultured human fibroblasts
derived from donors of various ages. Mech. Ageing and Dev. 13, 285 – 295.
Clark, A.J., Ishii, S., Richert, N., Merlino, G.T., Pastan, I., 1985. Epidermal growth factor regulates the
expression of its own receptor. Proc. Natl. Acad. Sci. USA 82, 8374 – 8378.
Colige, A., Nusgen, B., Lapiere, C.M., 1990. Response to epidermal growth factor of skin fibroblasts
from donors of varying age is modulated by extracellular matrix. J. Cell. Physiol. 145, 450 – 457.
Cowled, P.A., Ciccareli, C., Coccia, E., Philipson, L., Sorrentino, V., 1994. Expression of growth
arrest-specific (gas) genes in senescent murine cells. Exp. Cell Res. 211, 197 – 202.
Cristofallo, V.J., 1988. The regulation of cell senescence. Proc. Am. Philos. Soc. 132, 140 – 147.
Dereventzi, A., Ratan, S.I.S., Gonos, E.S., 1996. Molecular links between cellular mortality and
immortality (review). Anticancer Res. 16, 2901 – 2910.
Doggett, D.L., Rotenberg, M.O., Pignolo, R.J., Phillips, P.D., Cristofalo, V.J., 1992. Differential gene
expression between young and senescent, quiescent WI-38 cells. Mech. Ageing Dev. 65, 239 – 255.

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

39

Dominice, J., Levasseur, C., Larno, S., Ronot, X., Adolphe, M., 1986. Age-related changes in rabbit
articular chondrocytes. Mech. Ageing Dev. 37, 231 – 240.
Gerhard, G.S., Phillips, P.D., Cristofalo, V.J., 1991. EGF- and PDGF-stimulated phosphorylation in
young and senescent WI-38 cells. Exp. Cell Res. 193, 87 – 92.
Goldstein, S., 1990. Replicative senescence: the human fibroblast comes of age. Science 249, 1129 – 1133.
Goletz, T.J., Hensler, P.J., Ning, Y., Adami, C.R., Pereira-Smith, P.M., 1993. Evidence for a genetic
basis for the model system of cellular senescence. J. Am. Geriatr. Soc. 41, 1255 – 1258.
Golstein, S., Moerman, E.L., Soeldner, J.S., Gleason, R.E., Barnett, D.M., 1978. Chronologic and
physiologic age affect replicative life span of fibroblasts from diabetic, prediabetic, and normal
donors. Science 199, 781–782.
Gospodarowicz, D., Meschern, A.L., 1977. A comparison of the responses of cultured myoblasts and
chondrocytes to fibroblast and epidermal growth factor. J. Cell. Physiol. 93, 117 – 128.
Hayflick, L., 1965. The limited in vitro life-time of human diploid cell strain. Exp. Cell Res. 37, 614 – 636.
Hayflick, L., Moorhead, P.S., 1961. The serial cultivation of human diploid cell strains. Exp. Cell Res.
25, 585–621.
Hensler, P.J., Pereira-Smith, O.M., 1995. Human replicative senescence. A molecular study. Am. J.
Pathol. 147, 1–8.
Ishigami, A., Reed, T.D., Roth, G.S., 1993. Effect of aging on EGF stimulated DNA synthesis and EGF
receptor levels in primary cultured rat hepatocytes. Biochem. Biophys. Res. Commun. 196, 181 – 186.
Kaji, K., Matsuo, M., 1983. Responsiveness of human lung diploid fibroblast during aging in vitro to
epidermal growth factor: saturation density and lifespan. Mech. Ageing Dev. 22, 129 – 133.
Kinoshita, A., Takigawa, M., Suzuki, F., 1992. Demonstration of receptors for epidermal growth factor
on cultured rabbit chondrocytes and regulation of their expression by various growth and differentiation factors. Biochem. Biophys. Res. Commun. 183, 14 – 20.
Li, J., Zhang, Z., Tong, T., 1995. The proliferative response and anti-oncogen expression in old 2 BS
cells after growth factor stimulation. Mech. Ageing Dev. 80, 25 – 34.
Marti, U., 1993. Handling of epidermal growth factor and number of epidermal growth factor receptors
are changed in aged male rats. Hepatology 18, 1432 – 1436.
Martin, G.M., Sprague, C.A., Epstein, C.J., 1970. Replicative life-span of cultivated human cells. Lab.
Invest. 23, 86–92.
Matsuda, T., Okamura, K., Sato, Y., Morimot, A., Ono, M., Kohno, K., Kuwano, M., 1992. Decreased
response to epidermal growth factor during cellular senescence in cultured human microvascular
endothelial cells. J. Cell. Physiol. 150, 510 – 516.
Ning, Y., Pereira-Smith, O.M., 1991. Molecular genetic approaches to the study of cellular senescence.
Mutat. Res. 256, 303–310.
Norwood, T.H., Smith, J.R., Stein, G.H., 1990. Aging at the cellular level: the human fibroblast-like cell
model. In: Schneider, E.L., Rowe, J.W. (Eds.), Hand. Biol. Aging, 3rd ed. San Diego, CA, pp.
131–154.
Pang, J.H., Chen, K.Y., 1994. Global change of gene expression at late G1/S boundary may occur in
human IMR90 diploid fibroblasts during senescence. J. Cell. Physiol. 160, 531 – 538.
Phillips, P.D., Kuhnle, E., Cristofalo, V.J., 1983. [125I]EGF binding ability is stable through the
replicative life span of WI-38 cells. J. Cell. Physiol. 114, 311 – 316.
Phillips, P.D., Kaji, K., Cristofalo, V.J., 1984. Progressive loss of the proliferative response of senescing
WI-38 cells to platelet-derived growth factor, epidermal growth factor, insulin, transferrin, and
dexamethasone. J. Gerontol. 39, 11–17.
Ribault, D., Khatib, A.M., Panasuyk, A., Barbara, A., Bouizar, Z., Mitrovic, R.D., 1997. Mitogenic and
metabolic actions of epidermal growth factor on rat articular chondrocytes: modulation by fetal calf
serum, transforming growth factor-i, and tyrphostin. Arch. Biochem. Biophys. 337, 149 – 158.
Rittling, S.R., Brooks, K.M., Cristofalo, V.J., Baserga, R., 1986. Expression of cell cycle-dependent
genes in young and senescent WI-38 fibroblasts. Proc. Natl. Acad. Sci. USA 83, 3316 – 3320.
Saggi, S.J., Safirstein, R., Price, P.M., 1992. Cloning and sequencing of the rat preproepidermal growth
factor cDNA: comparison with mouse and human sequences. DNA Cell Biol. 11, 481 – 487.
Schneider, E.L., Mitsui, Y., 1976. The relationship between in vitro cellular ageing and in vivo human
age. Proc. Natl. Acad. Sci. USA 73, 3584 – 3588.

40

D. Ribault et al. / Mechanisms of Ageing and De6elopment 100 (1998) 25–40

Seshadri, T., Campisi, J., 1990. Repression of c-fos transcription and an altered genetic program in
senescent human fibroblasts. Science 247, 205 – 209.
Tahara, H., Sato, E., Noda, A., Ide, T., 1995. Increase in expression level of p21sdi 1/cip1/waf1 with
increasing division age in both normal and SV 40-transformed human fibroblasts. Oncogene 10,
835–840.
Tang, Z., Zongyu, Z., Zheng, Y., Corbley, M.J., Tong, T., 1994. Cell aging of human diploid fibroblasts
is associated with changes in responsiveness to epidermal growth factor and changes in HER-2
expression. Mech. Ageing Dev. 73, 57 – 67.
Tso, J.Y., Sun, X.H., Kao, T.H., Reece, K.S., Wu, R., 1985. Isolation and characterization of rat and
human glyceraldehyde-3-phosphate dehydrogenase cDNA: genomic complexity and molecular evolution of the gene. Nucleic Acids Res. 13, 2485 – 2502.
Vivien, D., Galera, P., Lebrun, E., Loyau, G., Pujol, J.P., 1990. Differential effects of transforming
growth factor-i and epidermal growth factor on the cell cycle of rabbit articular chondrocytes. J.
Cell. Physiol. 143, 534–545.
Waga, S., Hannon, G.J., Beach, D., Stillman, B., 1994. The p21 inhibitor of cycline-dependent kinases
controls DNA replication by interaction with PCNA. Nature 369, 574 – 578.
West, D.C., Sattar, A., Kumar, S., 1985. A simplified in situ solubilisation procedure for the determination of DNA and cell number in tissue cultured mammalian cells. Anal. Biochem. 147, 289 – 295.

.